Unknown

Dataset Information

0

A Chinese patient with 11?-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report.


ABSTRACT:

Background

Congenital adrenal hyperplasia (CAH) resulting from steroid 11?-hydroxylase deficiency (11?-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11?-OHD in a Chinese family.

Case presentation

A 19-year-old Chinese man was clinically diagnosed with 11?-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11?-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother.

Conclusions

A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11?-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.

SUBMITTER: Yuan X 

PROVIDER: S-EPMC6151069 | biostudies-literature | 2018 Sep

REPOSITORIES: biostudies-literature

altmetric image

Publications

A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report.

Yuan Xianxian X   Lu Lin L   Chen Shi S   Jiang Jun J   Wang Xiangqing X   Liu Zhihui Z   Zhu Huijuan H   Pan Hui H   Lu Zhaolin Z  

BMC endocrine disorders 20180921 1


<h4>Background</h4>Congenital adrenal hyperplasia (CAH) resulting from steroid 11β-hydroxylase deficiency (11β-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11β-OHD in a Chinese family.<h4>Case presentation</h4>A 19-year-old Chinese man was clinically diagnosed with 11β-OHD. His initial clinical manifestations included precocious puberty, hyperpigmenta  ...[more]

Similar Datasets

| S-EPMC4912772 | biostudies-literature
| S-EPMC4626658 | biostudies-literature
| S-EPMC6139905 | biostudies-literature
| S-EPMC9171383 | biostudies-literature
| S-EPMC4428642 | biostudies-literature
| S-EPMC3992560 | biostudies-literature
| S-EPMC5347606 | biostudies-literature
| S-EPMC9790122 | biostudies-literature
| S-EPMC6817513 | biostudies-literature
| S-EPMC5932988 | biostudies-literature