Dataset Information

A Chinese patient with 11?-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report.

ABSTRACT:

Background

Congenital adrenal hyperplasia (CAH) resulting from steroid 11?-hydroxylase deficiency (11?-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11?-OHD in a Chinese family.

Case presentation

A 19-year-old Chinese man was clinically diagnosed with 11?-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11?-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother.

Conclusions

A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11?-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.

SUBMITTER: Yuan X

PROVIDER: S-EPMC6151069 | biostudies-literature | 2018 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report.

Yuan Xianxian X Lu Lin L Chen Shi S Jiang Jun J Wang Xiangqing X Liu Zhihui Z Zhu Huijuan H Pan Hui H Lu Zhaolin Z

BMC endocrine disorders 20180921 1

<h4>Background</h4>Congenital adrenal hyperplasia (CAH) resulting from steroid 11β-hydroxylase deficiency (11β-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11β-OHD in a Chinese family.<h4>Case presentation</h4>A 19-year-old Chinese man was clinically diagnosed with 11β-OHD. His initial clinical manifestations included precocious puberty, hyperpigmenta ...[more]

PMID: 30241518

Similar Datasets

Project description:BackgroundCongenital adrenal hyperplasia (CAH) due to steroid 11β-hydroxylase deficiency (11β-OHD) is a rare form of CAH associated with low renin hypertension, hypokalemia, hyperandrogenemia and ambiguous genitalia in affected females. Herein we describe the clinical, hormonal and molecular characteristics of two Uzbekistan siblings with 11β-OHD and analyze the effects of a splicing mutation.Case presentationA 46,XX girl presented with genital ambiguity and low renin hypertension; her 46,XY brother presented with precocious puberty. Hormonal studies suggested 11β-OHD. Mutation analysis was performed by PCR followed by Sanger sequencing of the entire coding regions and their flanking introns of the CYP11B1 gene. Mutation analysis showed that both patients were compound heterozygous for IVS7 + 1G > A, and c.421C > T. Although the identified mutations have been previously described, this is, to our knowledge, the first report of these mutations in compound heterozygotes. A minigene assay was used to determine the effects of the splicing mutation. The constructs containing either the wild-type or the splice-site mutant CYP11B1 genomic DNA of exons-introns 6-9 were transfected into COS-7 cells; subsequently, RNA splicing was assessed by reversed transcribed-PCR of CYP11B1 complementary DNA. The minigene assay revealed that the IVS7 + 1G > A mutation resulted in two shorter incorrectly spliced products; one skipping the exon 7 and the other skipping the exons 7-8. The c.421C > T mutation leads to the introduction of a premature stop codon at residue 141 (p.R141X). These mutations are expected to code non-functional proteins.ConclusionCompound heterozygous mutations (IVS7 + 1G > A and p.R141X) in the CYP11B1 gene were found to cause 11β-OHD. The IVS7 + 1G > A mutation causes aberrant splicing of CYP11B1 leading to exon skipping. This finding could facilitate the future novel therapies targeted on splicing modulation to treat human disease.

Project description:Unlabelled11β-hydroxylase deficiency (11β-OHD), an autosomal recessive inherited disorder, accounts for 5-8% of congenital adrenal hyperplasia. In Greece, no cases of 11β-OHD have been described so far. The patient presented at the age of 13 months with mild virilization of external genitalia and pubic hair development since the age of 3 months. Hormonal profile showed elevated 11-deoxycortisol, adrenal androgens and ACTH levels. ACTH stimulation test was compatible with 11β-OHD. DNA of the proband and her parents was isolated and genotyped for CYP11B1 gene coding cytochrome P450c11. The girl was found to be compound heterozygous for two CYP11B1 novel mutations, p.Ala386Glu (exon 7), inherited from the father and p.Leu471Argin (exon 9) from the mother. Hydrocortisone supplementation therapy was initiated. Four years after presentation she remains normotensive, her growth pattern is normal and the bone age remains advanced despite adequate suppression of adrenal androgens.Learning points11β-hydroxylase (CYP11B1) deficiency (11OHD; OMIM +202010) is the second most common cause of CAH accounting for approximately 5-8% of cases with an incidence of 1:100 000-1:200 000 live births in non-consanguineous populations.Two CYP11B1 inactivating novel mutations, p.Ala386Glu and p.Leu471Arg are reportedRegarding newborn females, in utero androgen excess results in ambiguous genitalia, whereas in the male newborn diagnosis may go undetected. In infancy and childhood adrenal androgen overproduction results in peripheral precocious puberty in boys and various degrees of virilization in girls.Accumulation of 11-deoxycorticosterone and its metabolites causes hypertension in about two thirds of patients.Diagnosis lies upon elevated 11-deoxycortisol and DOC plus upstream precursors, such as 17α-hydroxyprogesterone and Δ4-androstenedione.The established treatment of steroid 11β-OHD is similar to that of steroid 21-hydroxylase deficiency and consists of glucocorticoid administration in order to reduce ACTH-driven DOC overproduction resulting in hypertension remission and improvement of the virilization symptoms.