Dataset Information

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.

ABSTRACT: In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.

SUBMITTER: Liu C

PROVIDER: S-EPMC6162610 | biostudies-literature | 2018 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.

Liu Chang C Chen Ze Z Hu Yue Y Ji Haishuo H Yu Deshui D Shen Wenyuan W Li Siyu S Ruan Jishou J Bu Wenjun W Gao Shan S

Genes 20180905 9

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented p ...[more]

PMID: 30189613

Similar Datasets

Project description:BackgroundErwinia amylovora is a phytopathogenic bacterium and causal agent of fire blight disease in apples and pears. Although many virulence factors have been characterized, the coordination of expression of these virulence factors in E. amylovora is still not clear. Regulatory small RNAs (sRNAs) are important post-transcriptional regulatory components in bacteria. A large number of sRNAs require the RNA chaperone Hfq for both stability and functional activation. In E. amylovora, Hfq was identified as a major regulator of virulence and various virulence traits. However, information is still lacking about Hfq-dependent sRNAs on a genome scale, including the virulence regulatory functions of these sRNAs in E. amylovora.ResultsUsing both an RNA-seq analysis and a Rho-independent terminator search, 40 candidate Hfq-dependent sRNAs were identified in E. amylovora. The expression and sizes of 12 sRNAs and the sequence boundaries of seven sRNAs were confirmed by Northern blot and 5' RACE assay respectively. Sequence conservation analysis identified sRNAs conserved only in the Erwinia genus as well as E. amylovora species-specific sRNAs. In addition, a dynamic re-patterning of expression of Hfq-dependent sRNAs was observed at 6 and 12 hours after induction in Hrp-inducing minimal medium. Furthermore, sRNAs that control virulence traits were characterized, among which ArcZ positively controls the type III secretion system (T3SS), amylovoran exopolysaccahride production, biofilm formation, and motility, and negatively modulates attachment while RmaA (Hrs6) and OmrAB both negatively regulate amylovoran production and positively regulate motility.ConclusionsThis study has significantly enhanced our understanding of the Hfq-dependent sRNAs in E. amylovora at the genome level. The identification of multiple virulence-regulating sRNAs also suggests that post-transcriptional regulation by sRNAs may play a role in the deployment of virulence factors needed during varying stages of pathogenesis during host invasion by E. amylovora.

Dataset Information

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.

Publications

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets