Dataset Information

Correlation between CTLA4 genetic polymorphisms, its serum protein level and the susceptibility to recurrent spontaneous abortion: A case-control study.

ABSTRACT: Present study was aimed to detect the influence of cytotoxic T-lymphocyte associated protein 4 (CTLA4) gene polymorphisms for the risk of recurrent spontaneous abortion (RSA), as well as the serum level of CTLA4 protein in RSA patients.One hundred thirty-three RSA patients and 146 healthy persons were recruited in this case-control study. PCR-RFLP was used to genotype the CTLA4 gene polymorphisms both in case and control groups. Serum level of CTLA4 was detected by ELISA kit. Quantitative variables were compared by t test or Mann-Whitney U test between groups. Qualitative variables were evaluated by ? test or Fisher exact test. Association strength was expressed by odds ratios (ORs) and 95% confidence intervals (95% CIs).G allele of rs4553808 (P?=?.027, OR?=?0.570, 95% CI?=?0.345-0.942) and T allele of rs5742909 (P?=?.027, OR?=?0.570, 95% CI?=?0.345-0.942) were distinctly associated with reduced susceptibility of RSA. Distinctly negative association has been discovered between rs231775 AA genotype and RSA susceptibility (P?=?.040, OR?=?0.427, 95% CI?=?0.188-0.973). CTLA4 protein had significantly higher serum level in RSA patients than in healthy controls (P?=?.028). In RSA patients, AA genotype carriers had higher CTLA4 serum level than that GG genotype carriers (17.83?±?6.35?ng/mL vs 10.41?±?7.28?ng/mL, P?=?.039).Minor alleles of CTLA4 polymorphisms might inhibit the RSA susceptibility via upregulated the protein expression level.

SUBMITTER: Li L

PROVIDER: S-EPMC6211885 | biostudies-literature | 2018 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Correlation between CTLA4 genetic polymorphisms, its serum protein level and the susceptibility to recurrent spontaneous abortion: A case-control study.

Li Li L Liu Jia J Qin Shuang S Li Ruiman R

Medicine 20181001 42

Present study was aimed to detect the influence of cytotoxic T-lymphocyte associated protein 4 (CTLA4) gene polymorphisms for the risk of recurrent spontaneous abortion (RSA), as well as the serum level of CTLA4 protein in RSA patients.One hundred thirty-three RSA patients and 146 healthy persons were recruited in this case-control study. PCR-RFLP was used to genotype the CTLA4 gene polymorphisms both in case and control groups. Serum level of CTLA4 was detected by ELISA kit. Quantitative variab ...[more]

PMID: 30334961

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Correlation between CTLA4 genetic polymorphisms, its serum protein level and the susceptibility to recurrent spontaneous abortion: A case-control study.

Publications

Correlation between CTLA4 genetic polymorphisms, its serum protein level and the susceptibility to recurrent spontaneous abortion: A case-control study.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets