Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A Click Chemistry Approach towards Flavin-Cyclodextrin Conjugates-Bioinspired Sulfoxidation Catalysts.

ABSTRACT: A click chemistry approach based on the reaction between alkynylflavins and mono(6-azido-6-deoxy)-?-cyclodextrin has proven to be a useful tool for the synthesis of flavin-cyclodextrin conjugates studied as monooxygenase mimics in enantioselective sulfoxidations.

SUBMITTER: Tomanova P

PROVIDER: S-EPMC6331787 | biostudies-literature | 2015 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

A Click Chemistry Approach towards Flavin-Cyclodextrin Conjugates-Bioinspired Sulfoxidation Catalysts.

Tomanová Petra P Šturala Jiří J Buděšínský Miloš M Cibulka Radek R

Molecules (Basel, Switzerland) 20151104 11

A click chemistry approach based on the reaction between alkynylflavins and mono(6-azido-6-deoxy)-β-cyclodextrin has proven to be a useful tool for the synthesis of flavin-cyclodextrin conjugates studied as monooxygenase mimics in enantioselective sulfoxidations. ...[more]

PMID: 26556319

Similar Datasets

Bioinspired glycosaminoglycan hydrogels via click chemistry for 3D dynamic cell encapsulation.

Project description:Cell encapsulation within 3D hydrogels is an attractive approach to develop effective cell-based therapies. However, little is known about how cells respond to the dynamic microenvironment resulting from hydrogel gelation-based cell encapsulation. Here, a tunable biomimetic hydrogel system that possesses alterable gelation kinetics and biologically relevant matrix stiffness is developed to study 3D dynamic cellular responses during encapsulation. Hydrogels are synthesized by cross-linking thiolated hyaluronic acid and thiolated chondroitin sulfate with polyethylene glycol diacrylate under cell-compatible conditions. Hydrogel properties are tailored by altering thiol substitution degrees of glycosaminoglycans or molecular weights of cross-linkers. Encapsulation of human mesenchymal stem cells through hydrogel gelation reveals high cell viability as well as a three-stage gelation-dependent cellular response in real-time focal adhesion kinase (FAK) phosphorylation in live single cells. Furthermore, stiffer hydrogels result in higher equilibrium FAK activity and enhanced actin protrusions. Our results demonstrate the promise of hydrogel-mediated cellular responses during cell encapsulation.

| S-EPMC6749605 | biostudies-literature

Bioorthogonal "Click Chemistry" Bone Cement with Bioinspired Natural Mimicking Microstructures for Bone Repair.

Project description:Current bone cement systems often demand free radical or metal-related initiators and/or catalysts for the crosslinking process, which may cause serious toxicity to the human body. In addition, the resultant dense scaffolds may have a prolonged degradation time and are difficult for cells to infiltrate and form new tissue. In this study, we developed a porous "click" organic-inorganic nanohybrid (PO-click-ON) cement that crosslinks via metal-free biorthogonal click chemistry and forms porous structures mimicking the native bone tissue via particulate leaching. Strain-promoted click reaction enables fast and efficient crosslinking of polymer chains with the exclusion of any toxic initiator or catalyst. The resulting PO-click-ON implants supported exceptional in vitro stem cell adhesion and osteogenic differentiation with a large portion of stem cells infiltrated deep into the scaffolds. In vivo study using a rat cranial defect model demonstrated that the PO-click-ON system achieved outstanding cell adsorption, neovascularization, and bone formation. The porous click cement developed in this study serves as a promising platform with multifunctionality for bone and other tissue engineering applications.

| S-EPMC10123962 | biostudies-literature

Non-Genetic Generation of Antibody Conjugates Based on Chemoenzymatic Tyrosine Click Chemistry.

Project description:The availability of tools to generate homogeneous and stable antibody conjugates without recombinant DNA technology is a valuable asset in fields spanning from in vitro diagnostics to in vivo imaging and therapeutics. We present here a general approach for the conjugation to human IgG1 antibodies, by employing a straightforward two-stage protocol based on antibody deglycosylation followed by tyrosinase-mediated ortho-quinone strain-promoted click chemistry. The technology is validated by the efficient and clean generation of highly potent DAR2 and DAR4 antibody-drug conjugates (ADCs) with cytotoxic payloads MMAE or PBD dimer, and their in vitro evaluation.

| S-EPMC8532111 | biostudies-literature

Click chemistry towards thermally reversible photochromic 4,5-bisthiazolyl-1,2,3-triazoles.

Project description:Three new diarylethenes were synthesized from 1,2-bis(5-methyl-2-(4-substituted-phenyl)thiazol-4-yl)ethyne and benzyl azide through Ru(I)-catalyzed Huisgen cyclization reactions. The 4,5-bisthiazolyl-1,2,3-triazoles thus prepared, which belong to the terarylene family, showed thermally reversible photochromism. The absorption maximum wavelengths of the closed forms are longer than other terarylenes reported so far. The thermal back reactions are much faster when the substituents on the terminal phenyl groups are electron-withdrawing cyano groups than when they are electron-donating methoxy groups.

| S-EPMC6753672 | biostudies-literature

The facile synthesis of multifunctional PAMAM dendrimer conjugates through copper-free click chemistry.

Project description:The facile conjugation of three azido modified functionalities, namely a therapeutic drug (methotrexate), a targeting moiety (folic acid), and an imaging agent (fluorescein) with a G5 PAMAM dendrimer scaffold with cyclooctyne molecules at the surface through copper-free click chemistry is reported. Mono-, di-, and tri-functional PAMAM dendrimer conjugates can be obtained via combinatorial mixing of different azido modified functionalities simultaneously or sequentially with the dendrimer platform. Preliminary flow cytometry results indicate that the folic acid targeted nanoparticles are efficiently binding with KB cells.

| S-EPMC3331967 | biostudies-literature

Click chemistry-assisted synthesis of triazolo linked podophyllotoxin conjugates as tubulin polymerization inhibitors.

Project description:A series of new triazolo linked 4β-amidopodophyllotoxin conjugates (9a-l) were synthesized using click chemistry and evaluated for their antitumor activity against four human cancer cell lines. Among them, two compounds (9c and 9j) showed significant anticancer activity with IC50 values of 0.9 and 0.07 μM, respectively. Biological studies are conducted into the cell-cycle distribution of these conjugates inducing G2/M-phase arrest, apart from an increase in the levels of caspase-3 proteins, followed by apoptotic cell death. A tubulin polymerization assay analysis showed that these compounds effectively inhibit microtubule assembly in HeLa cells and, moreover, Hoechst 33258 and Immunohistochemistry staining suggest that these compounds induce cell death by apoptosis. The docking studies showed that compounds 9c and 9j interact and bind efficiently with the tubulin protein at the colchicine site.

| S-EPMC6084182 | biostudies-literature

Click and Cut: a click chemistry approach to developing oxidative DNA damaging agents.

Project description:Metallodrugs provide important first-line treatment against various forms of human cancer. To overcome chemotherapeutic resistance and widen treatment possibilities, new agents with improved or alternative modes of action are highly sought after. Here, we present a click chemistry strategy for developing DNA damaging metallodrugs. The approach involves the development of a series of polyamine ligands where three primary, secondary or tertiary alkyne-amines were selected and 'clicked' using the copper-catalysed azide-alkyne cycloaddition reaction to a 1,3,5-azide mesitylene core to produce a family of compounds we call the 'Tri-Click' (TC) series. From the isolated library, one dominant ligand (TC1) emerged as a high-affinity copper(II) binding agent with potent DNA recognition and damaging properties. Using a range of in vitro biophysical and molecular techniques-including free radical scavengers, spin trapping antioxidants and base excision repair (BER) enzymes-the oxidative DNA damaging mechanism of copper-bound TC1 was elucidated. This activity was then compared to intracellular results obtained from peripheral blood mononuclear cells exposed to Cu(II)-TC1 where use of BER enzymes and fluorescently modified dNTPs enabled the characterisation and quantification of genomic DNA lesions produced by the complex. The approach can serve as a new avenue for the design of DNA damaging agents with unique activity profiles.

| S-EPMC8501983 | biostudies-literature

Initial Steps towards Spatiotemporal Signaling through Biomaterials Using Click-to-Release Chemistry.

Project description:The process of wound healing is a tightly controlled cascade of events, where severe skin wounds are resolved via scar tissue. This fibrotic response may be diminished by applying anti-fibrotic factors to the wound, thereby stimulating regeneration over scarring. The development of tunable biomaterials that enable spatiotemporal control over the release of anti-fibrotics would greatly benefit wound healing. Herein, harnessing the power of click-to-release chemistry for regenerative medicine, we demonstrate the feasibility of such an approach. For this purpose, one side of a bis-N-hydroxysuccinimide-trans-cyclooctene (TCO) linker was functionalized with human epidermal growth factor (hEGF), an important regulator during wound healing, whereas on the other side a carrier protein was conjugated-either type I collagen scaffolds or bovine serum albumin (BSA). Mass spectrometry demonstrated the coupling of hEGF-TCO and indicated a release following exposure to dimethyl-tetrazine. Type I collagen scaffolds could be functionalized with the hEGF-TCO complex as demonstrated by immunofluorescence staining and Western blotting. The hEGF-TCO complex was also successfully ligated to BSA and the partial release of hEGF upon dimethyl-tetrazine exposure was observed through Western blotting. This work establishes the potential of click-to-release chemistry for the development of pro-regenerative biomaterials.

| S-EPMC9610979 | biostudies-literature

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

| S-EPMC8835054 | biostudies-literature

Click chemistry enables comprehensive preclinical evaluation of targeted epigenetic therapies [Click-Seq 2]

Project description:The success of targeted therapies hinges on our ability to understand the molecular and cellular mechanism of action of these agents. Here we modify various BET bromodomain inhibitors, an exemplar novel targeted therapy, to create functionally conserved compounds that are amenable to click-chemistry and can be used as molecular probes in vitro and in vivo. Using click-proteomics and click-sequencing we provide new mechanistic insights to explain the gene regulatory function of BRD4 and the transcriptional changes invoked by BET inhibitors. In mouse models of acute leukaemia, we use high resolution microscopy and flow cytometry to highlight the underappreciated heterogeneity of drug activity within tumour cells located in different tissue compartments. We also demonstrate the differential distribution and effects of the drug in normal and malignant cells in vivo. These data provide critical insights that reveal the cellular and molecular details for the efficacy and limitations of these agents. This study provides a framework for the pre-clinical assessment of other conventional and targeted therapies.

2017-07-13 | GSE88749 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data