Dataset Information

A decade of using small-to-medium throughput allele discrimination assay to determine prion protein gene ( Prnp) genotypes in sheep in Slovenia.

ABSTRACT: Sheep with valine (V) at codon 136 and glutamine (Q) at codon 171 of the prion protein gene ( Prnp) are highly susceptible to classical scrapie, whereas phenylalanine (F) at codon 141 and histidine (H) at codon 154 play a major role in the susceptibility to atypical scrapie. A TaqMan real-time PCR assay was developed to determine Prnp alleles at codons 136, 141, 154, and 171 and used in classical scrapie eradication and breeding programs adopted in Slovenia. The frequency of the most resistant genotypes ARR/ARR and ARR/ARQ increased significantly in tested animals ( n = 35,138) from 6.7 and 27.1% of the tested sheep in 2006 to 12.1 and 32.4%, respectively, in 2015. Frequencies of more susceptible genotypes ARQ/ARQ and ARQ/VRQ decreased significantly from 36.4 and 3.5% in 2006 to 31.1 and 1.8%, respectively, in 2015. The most susceptible genotype VRQ/VRQ was detected in <0.5% of tested sheep. Frequencies of alleles AFRQ and AHQ affecting the susceptibility to atypical scrapie did not change significantly. The developed assay was suitable for genotyping on a small-to-medium throughput scale and was successfully used in classical scrapie eradication, as well as for the selection of classical scrapie-resistant sheep within breeding programs in Slovenia.

SUBMITTER: Zabavnik J

PROVIDER: S-EPMC6504162 | biostudies-literature | 2018 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A decade of using small-to-medium throughput allele discrimination assay to determine prion protein gene ( Prnp) genotypes in sheep in Slovenia.

Zabavnik Jelka J Cotman Marko M Juntes Polona P Ambrozic Ivan I

Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 20170914 1

Sheep with valine (V) at codon 136 and glutamine (Q) at codon 171 of the prion protein gene ( Prnp) are highly susceptible to classical scrapie, whereas phenylalanine (F) at codon 141 and histidine (H) at codon 154 play a major role in the susceptibility to atypical scrapie. A TaqMan real-time PCR assay was developed to determine Prnp alleles at codons 136, 141, 154, and 171 and used in classical scrapie eradication and breeding programs adopted in Slovenia. The frequency of the most resistant g ...[more]

PMID: 28906181

Similar Datasets

Project description:We investigated the expression of prion protein gene both on mRNA and protein levels in bovine and ovine female reproductive organs during gestation and various tissues of their fetuses. The fetal tissues of both species included brain, cotyledon, heart, intestine, kidney, liver, lung, and muscle. In cattle, prion protein gene (PRNP) transcripts were detected by semiquantitative RT-PCR in reproductive tissues such as ovary, oviduct, endometrium, myometrium, follicles, and granulosa cells. In various tissues of 2-month-old fetuses, higher expression levels were found in brain and cotyledon compared to the other tissues. To detect the expression of the gene transcript in in vivo preimplantation embryos and 1-month-old fetuses, real-time PCR was performed showing that the level of gene expression in zygote stage was significantly higher (p < or = 0.05) than that of the other stages. Sheep were categorized as resistant (RI) or high susceptible (R5) to scrapie according to their PRNP genotype. In both genotype groups, the PRNP mRNA was detectable in all tissues studied including ovary, oviduct, endometrium, myometrium, and caruncle of ewes and all tissues of 2-month-old fetuses of both groups. Comparison between reproductive organs demonstrates the highest expression level in caruncle tissue of R1 ewes, whereas the level was high in brain and low in liver of both R1 and R5 fetuses. In addition, real-time RT-PCR was performed in immature oocytes, mature oocytes, in vivo embryos at morula stage, and 1-month-old fetuses. The results showed that the relative expression levels of the ovine PRNP mRNA in mature oocytes and morula stage embryos were significantly lower than those in immature oocytes and 1-month-old fetuses (p < or = 0.05). Western blot analyses revealed the immunoreactive bands corresponding to the cellular prion protein (PrPc) in all maternal and fetal tissues examined of both cattle and sheep. Moreover, immunohistochemical staining implicated localization of the PrPc in ovarian cortex and ovarian medulla of both species. However, PrPc was not detected in oocyte, granulosa cells, theca cells, and corpus luteum in this study.

Project description:High prion protein (PrP) levels are associated with breast, colon and gastric cancer resistance to treatment and with a poor prognosis for the patients. However, little is known about the underlying molecular mechanism(s) regulating human PrP gene (PRNP) expression in cancers. Because endoplasmic reticulum (ER) stress is associated with solid tumors, we investigated a possible regulation of PRNP gene expression by ER stress.Published microarray databases of breast cancer tissues and breast carcinoma cell lines were analyzed for PrP mRNA and ER stress marker immunoglobulin heavy chain binding protein (BiP) levels. Breast cancer tissue microarrays (TMA) were immunostained for BiP and PrP. Breast carcinoma MCF-7, MDA-MB-231, HS578T and HCC1500 cells were treated with three different ER stressors - Brefeldin A, Tunicamycin, Thapsigargin - and levels of PrP mRNA or protein assessed by RT-PCR and Western blot analyses. A human PRNP promoter-luciferase reporter was used to assess transcriptional activation by ER stressors. Site-directed mutagenesis identified the ER stress response elements (ERSE). Chromatin immunoprecipitation (ChIP) analyses were done to identify the ER stress-mediated transcriptional regulators. The role of cleaved activating transcription factor 6? (?ATF6?) and spliced X-box protein-1 (sXBP1) in PRNP gene expression was assessed with over-expression or silencing techniques. The role of PrP protection against ER stress was assessed with PrP siRNA and by using Prnp null cell lines.We find that mRNA levels of BiP correlated with PrP transcript levels in breast cancer tissues and breast carcinoma cell lines. PrP mRNA levels were enriched in the basal subtype and were associated with poor prognosis in breast cancer patients. Higher PrP and BiP levels correlated with increasing tumor grade in TMA. ER stress was a positive regulator of PRNP gene transcription in MCF-7 cells and luciferase reporter assays identified one ER stress response element (ERSE) conserved among primates and rodents and three primate-specific ERSEs that regulated PRNP gene expression. Among the various transactivators of the ER stress-regulated unfolded protein response (UPR), ATF6? and XBP1 transactivated PRNP gene expression, but the ability of these varied in different cell types. Functionally, PrP delayed ER stress-induced cell death.These results establish PRNP as a novel ER stress-regulated gene that could increase survival in breast cancers.

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Dataset Information

A decade of using small-to-medium throughput allele discrimination assay to determine prion protein gene ( Prnp) genotypes in sheep in Slovenia.

Publications

A decade of using small-to-medium throughput allele discrimination assay to determine prion protein gene ( Prnp) genotypes in sheep in Slovenia.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets