Dataset Information

Two novel ANK1 loss-of-function mutations in Chinese families with hereditary spherocytosis.

ABSTRACT: Hereditary spherocytosis (HS) is the most common inherited haemolytic anaemia disorder. ANK1 mutations account for most HS cases, but pathogenicity analysis and functional research have not been widely performed for these mutations. In this study, in order to confirm diagnosis, gene mutation was screened in two unrelated Chinese families with HS by a next-generation sequencing (NGS) panel and then confirmed by Sanger sequencing. Two novel heterozygous mutations (c.C841T, p.R281X and c.T290G, p.L97R) of the ANK1 gene were identified in the two families respectively. Then, the pathogenicity of the two new mutations and two previously reported ANK1 mutations (c.C648G, p.Y216X and c.G424T, p.E142X) were studied by in vitro experiments. The four mutations increased the osmotic fragility of cells, reduced the stabilities of ANK1 proteins and prevented the protein from localizing to the plasma membrane and interacting with SPTB and SLC4A1. We classified these four mutations into disease-causing mutations for HS. Thus, conducting the same mutation test and providing genetic counselling for the two families were meaningful and significant. Moreover, the identification of two novel mutations enriches the ANK1 mutation database, especially in China.

SUBMITTER: Hao L

PROVIDER: S-EPMC6533472 | biostudies-literature | 2019 Jun

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Two novel ANK1 loss-of-function mutations in Chinese families with hereditary spherocytosis.

Hao Lili L Li Shanshan S Ma Duan D Chen Shiyu S Zhang Bowen B Xiao Deyong D Zhang Jin J Jiang Nan N Jiang Shayi S Ma Jing J

Journal of cellular and molecular medicine 20190423 6

Hereditary spherocytosis (HS) is the most common inherited haemolytic anaemia disorder. ANK1 mutations account for most HS cases, but pathogenicity analysis and functional research have not been widely performed for these mutations. In this study, in order to confirm diagnosis, gene mutation was screened in two unrelated Chinese families with HS by a next-generation sequencing (NGS) panel and then confirmed by Sanger sequencing. Two novel heterozygous mutations (c.C841T, p.R281X and c.T290G, p.L ...[more]

PMID: 31016877

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Two novel ANK1 loss-of-function mutations in Chinese families with hereditary spherocytosis.

Publications

Two novel ANK1 loss-of-function mutations in Chinese families with hereditary spherocytosis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets