Dataset Information

Melon RNA interference (RNAi) lines silenced for Cm-eIF4E show broad virus resistance.

ABSTRACT: Efficient and sustainable control of plant viruses may be achieved using genetically resistant crop varieties, although resistance genes are not always available for each pathogen; in this regard, the identification of new genes that are able to confer broad-spectrum and durable resistance is highly desirable. Recently, the cloning and characterization of recessive resistance genes from different plant species has pointed towards eukaryotic translation initiation factors (eIF) of the 4E family as factors required for the multiplication of many different viruses. Thus, we hypothesized that eIF4E may control the susceptibility of melon (Cucumis melo L.) to a broad range of viruses. To test this hypothesis, Cm-eIF4E knockdown melon plants were generated by the transformation of explants with a construct that was designed to induce the silencing of this gene, and the plants from T2 generations were genetically and phenotypically characterized. In transformed plants, Cm-eIF4E was specifically silenced, as identified by the decreased accumulation of Cm-eIF4E mRNA and the appearance of small interfering RNAs derived from the transgene, whereas the Cm-eIF(iso)4E mRNA levels remained unaffected. We challenged these transgenic melon plants with eight agronomically important melon-infecting viruses, and identified that they were resistant to Cucumber vein yellowing virus (CVYV), Melon necrotic spot virus (MNSV), Moroccan watermelon mosaic virus (MWMV) and Zucchini yellow mosaic virus (ZYMV), indicating that Cm-eIF4E controls melon susceptibility to these four viruses. Therefore, Cm-eIF4E is an efficient target for the identification of new resistance alleles able to confer broad-spectrum virus resistance in melon.

SUBMITTER: Rodriguez-Hernandez AM

PROVIDER: S-EPMC6638723 | biostudies-literature | 2012 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Melon RNA interference (RNAi) lines silenced for Cm-eIF4E show broad virus resistance.

Rodríguez-Hernández Ana M AM Gosalvez Blanca B Sempere Raquel N RN Burgos Lorenzo L Aranda Miguel A MA Truniger Verónica V

Molecular plant pathology 20120206 7

Efficient and sustainable control of plant viruses may be achieved using genetically resistant crop varieties, although resistance genes are not always available for each pathogen; in this regard, the identification of new genes that are able to confer broad-spectrum and durable resistance is highly desirable. Recently, the cloning and characterization of recessive resistance genes from different plant species has pointed towards eukaryotic translation initiation factors (eIF) of the 4E family a ...[more]

PMID: 22309030

Similar Datasets

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Project description:IntroductionPaclitaxel is a widely used drug in the treatment of patients with locally advanced and metastatic breast cancer. However, only a small portion of patients have a complete response to paclitaxel-based chemotherapy, and many patients are resistant. Strategies that increase sensitivity and limit resistance to paclitaxel would be of clinical use, especially for patients with triple-negative breast cancer (TNBC).MethodsWe generated a gene set from overlay of the druggable genome and a collection of genomically deregulated gene transcripts in breast cancer. We used loss-of-function RNA interference (RNAi) to identify gene products in this set that, when targeted, increase paclitaxel sensitivity. Pharmacological agents that targeted the top scoring hits/genes from our RNAi screens were used in combination with paclitaxel, and the effects on the growth of various breast cancer cell lines were determined.ResultsRNAi screens performed herein were validated by identification of genes in pathways that, when previously targeted, enhanced paclitaxel sensitivity in the pre-clinical and clinical settings. When chemical inhibitors, CCT007093 and mithramycin, against two top hits in our screen, PPMID and SP1, respectively, were used in combination with paclitaxel, we observed synergistic growth inhibition in both 2D and 3D breast cancer cell cultures. The transforming growth factor beta (TGFbeta) receptor inhibitor, LY2109761, that targets the signaling pathway of another top scoring hit, TGFbeta1, was synergistic with paclitaxel when used in combination on select breast cancer cell lines grown in 3D culture. We also determined the relative paclitaxel sensitivity of 22 TNBC cell lines and identified 18 drug-sensitive and four drug-resistant cell lines. Of significance, we found that both CCT007093 and mithramycin, when used in combination with paclitaxel, resulted in synergistic inhibition of the four paclitaxel-resistant TNBC cell lines.ConclusionsRNAi screening can identify druggable targets and novel drug combinations that can sensitize breast cancer cells to paclitaxel. This genomic-based approach can be applied to a multitude of tumor-derived cell lines and drug treatments to generate requisite pre-clinical data for new drug combination therapies to pursue in clinical investigations.

Dataset Information

Melon RNA interference (RNAi) lines silenced for Cm-eIF4E show broad virus resistance.

Publications

Melon RNA interference (RNAi) lines silenced for Cm-eIF4E show broad virus resistance.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets