Dataset Information

A new regulatory mechanism for Raf kinase activation, retinoic acid-bound Crabp1.

ABSTRACT: The rapidly accelerated fibrosarcoma (Raf) kinase is canonically activated by growth factors that regulate multiple cellular processes. In this kinase cascade Raf activation ultimately results in extracellular regulated kinase 1/2 (Erk1/2) activation, which requires Ras binding to the Ras binding domain (RBD) of Raf. We recently reported that all-trans retinoic acid (atRA) rapidly (within minutes) activates Erk1/2 to modulate cell cycle progression in stem cells, which is mediated by cellular retinoic acid binding protein 1 (Crabp1). But how atRA-bound Crabp1 regulated Erk1/2 activity remained unclear. We now report Raf kinase as the direct target of atRA-Crabp1. Molecularly, Crabp1 acts as a novel atRA-inducible scaffold protein for Raf/Mek/Erk in cells without growth factor stimulation. However, Crabp1 can also compete with Ras for direct interaction with the RBD of Raf, thereby negatively modulating growth factor-stimulated Raf activation, which can be enhanced by atRA binding to Crabp1. NMR heteronuclear single quantum coherence (HSQC) analyses reveal the 6-strand ?-sheet face of Crabp1 as its Raf-interaction surface. We identify a new atRA-mimicking and Crabp1-selective compound, C3, that can also elicit such an activity. This study uncovers a new signal crosstalk between endocrine (atRA-Crabp1) and growth factor (Ras-Raf) pathways, providing evidence for atRA-Crabp1 as a novel modulator of cell growth. The study also suggests a new therapeutic strategy by employing Crabp1-selective compounds to dampen growth factor stimulation while circumventing RAR-mediated retinoid toxicity.

SUBMITTER: Park SW

PROVIDER: S-EPMC6662813 | biostudies-literature | 2019 Jul

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A new regulatory mechanism for Raf kinase activation, retinoic acid-bound Crabp1.

Park Sung Wook SW Nhieu Jennifer J Persaud Shawna D SD Miller Michelle C MC Xia Youlin Y Lin Yi-Wei YW Lin Yu-Lung YL Kagechika Hiroyuki H Mayo Kevin H KH Wei Li-Na LN

Scientific reports 20190729 1

The rapidly accelerated fibrosarcoma (Raf) kinase is canonically activated by growth factors that regulate multiple cellular processes. In this kinase cascade Raf activation ultimately results in extracellular regulated kinase 1/2 (Erk1/2) activation, which requires Ras binding to the Ras binding domain (RBD) of Raf. We recently reported that all-trans retinoic acid (atRA) rapidly (within minutes) activates Erk1/2 to modulate cell cycle progression in stem cells, which is mediated by cellular re ...[more]

PMID: 31358819

Similar Datasets

Project description:The multivariate nature of cancer necessitates multi-targeted therapy, and kinase inhibitors account for a vast majority of approved cancer therapeutics. While acute promyelocytic leukemia (APL) patients are highly responsive to retinoic acid (RA) therapy, kinase inhibitors have been gaining momentum as co-treatments with RA for non-APL acute myeloid leukemia (AML) differentiation therapies, especially as a means to treat relapsed or refractory AML patients. In this study GW5074 (a c-Raf inhibitor) and PP2 (a Src-family kinase inhibitor) enhanced RA-induced maturation of t(15;17)-negative myeloblastic leukemia cells and rescued response in RA-resistant cells. PD98059 (a MEK inhibitor) and Akti-1/2 (an Akt inhibitor) were less effective, but did tend to promote maturation-uncoupled G1/G0 arrest, while wortmannin (a PI3K inhibitor) did not enhance differentiation surface marker expression or growth arrest. PD98059 and Akti-1/2 did not enhance differentiation markers and have potential, antagonistic off-targets effects on the aryl hydrocarbon receptor (AhR), but neither could the AhR agonist 6-formylindolo(3,2-b)carbazole (FICZ) rescue differentiation events in the RA-resistant cells. GW5074 rescued early CD38 expression in RA-resistant cells exhibiting an early block in differentiation before CD38 expression, while for RA-resistant cells with differentiation blocked later, PP2 rescued the later differentiation marker CD11b; but surprisingly, the combination of the two was not synergistic. Kinases c-Raf, Src-family kinases Lyn and Fgr, and PI3K display highly correlated signaling changes during RA treatment, while activation of traditional downstream targets (Akt, MEK/ERK), and even the surface marker CD38, were poorly correlated with c-Raf or Lyn during differentiation. This suggests that an interrelated kinase module involving c-Raf, PI3K, Lyn and perhaps Fgr functions in a nontraditional way during RA-induced maturation or during rescue of RA induction therapy using inhibitor co-treatment in RA-resistant leukemia cells.

Project description:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in ?-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ?-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ?-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

Project description:Retinoids have been studied extensively for their potential as therapeutic and chemopreventive agents for a variety of cancers, including nonmelanoma skin cancer (NMSC). Despite their use for many years, the mechanism of action of retinoids in the prevention of NMSC is still unclear. In this study we have attempted to understand the chemopreventive mechanism of all-trans retinoic acid (ATRA), a primary biologically active retinoid, in order to more efficiently utilize retinoids in the clinic.We have used the 2-stage dimethylbenzanthracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA) mouse skin carcinogenesis model to investigate the chemopreventive effects of ATRA. We have compared the gene expression profiles of control skin to skin subjected to the 2-stage protocol, with or without ATRA, using Affymetrix 430 2.0 DNA microarrays. Approximately 49% of the genes showing altered expression with TPA treatment are conversely affected when ATRA is co-administered. The activity of these genes, which we refer to as 'counter-regulated', may contribute to chemoprevention by ATRA. The counter-regulated genes have been clustered into functional categories and bioinformatic analysis has identified the B-Raf/Mek/Erk branch of the MAP kinase pathway as one containing several genes whose upregulation by TPA is blocked by ATRA. We also show that ATRA blocks signaling through this pathway, as revealed by immunohistochemistry and Western blotting. Finally, we found that blocking the B-Raf/Mek/Erk pathway with a pharmacological inhibitor, Sorafenib (BAY43-9006), induces squamous differentiation of existing skin SCCs formed in the 2-stage model.These results indicate that ATRA targets the B-Raf/Mek/Erk signaling pathway in the 2-stage mouse skin carcinogenesis model and this activity coincides with its chemopreventive action. This demonstrates the potential for targeting the B-Raf/Mek/Erk pathway for chemoprevention and therapy of skin SCC in humans. In addition our DNA microarray results provide the first expression signature for the chemopreventive effect of ATRA in a mouse skin cancer model. This is a potential source for novel targets for ATRA and other chemopreventive and therapeutic agents that can eventually be tested in the clinic.

Dataset Information

A new regulatory mechanism for Raf kinase activation, retinoic acid-bound Crabp1.

Publications

A new regulatory mechanism for Raf kinase activation, retinoic acid-bound Crabp1.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets