Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Functionalized Magnetic Nanoparticles as Catalysts for Enantioselective Henry Reaction.

ABSTRACT: With the aim to easily recover and reuse the catalyst, an efficient amino alcohol catalyst previously tested in the asymmetric addition of diethylzinc to several aromatic aldehydes has been immobilized on proper functionalized superparamagnetic core-shell magnetite-silica nanoparticles and employed in the Henry reaction in the semi-homogeneous phase. The nanocatalyst exhibits a promising catalytic activity that remains unchanged in the three catalytic cycles performed. The results prove that highly efficient catalysts, by being immobilized on suitable magnetic nanosupports, can be easily recovered and reused, maintaining their catalytic behavior.

SUBMITTER: Sappino C

PROVIDER: S-EPMC6933584 | biostudies-literature | 2019 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Functionalized Magnetic Nanoparticles as Catalysts for Enantioselective Henry Reaction.

Sappino Carla C Primitivo Ludovica L De Angelis Martina M Domenici Marzia Oneto MO Mastrodonato Andrea A Romdan Ilaria Ben IB Tatangelo Chiara C Suber Lorenza L Pilloni Luciano L Ricelli Alessandra A Righi Giuliana G

ACS omega 20191209 26

With the aim to easily recover and reuse the catalyst, an efficient amino alcohol catalyst previously tested in the asymmetric addition of diethylzinc to several aromatic aldehydes has been immobilized on proper functionalized superparamagnetic core-shell magnetite-silica nanoparticles and employed in the Henry reaction in the semi-homogeneous phase. The nanocatalyst exhibits a promising catalytic activity that remains unchanged in the three catalytic cycles performed. The results prove that hig ...[more]

PMID: 31891058

Similar Datasets

Covalently Functionalized DNA Duplexes and Quadruplexes as Hybrid Catalysts in an Enantioselective Friedel-Crafts Reaction.

Project description:The precise site-specific positioning of metal-ligand complexes on various DNA structures through covalent linkages has gained importance in the development of hybrid catalysts for aqueous-phase homogeneous catalysis. Covalently modified double-stranded and G-quadruplex DNA-based hybrid catalysts have been investigated separately. To understand the role of different DNA secondary structures in enantioselective Friedel-Crafts alkylation, a well-known G-quadruplex-forming sequence was covalently modified at different positions. The catalytic performance of this modified DNA strand was studied in the presence and absence of a complementary DNA sequence, resulting in the formation of two different secondary structures, namely duplex and G-quadruplex. Indeed, the secondary structures had a tremendous effect on both the yield and stereoselectivity of the catalyzed reaction. In addition, the position of the modification, the topology of the DNA, the nature of the ligand, and the length of the linker between ligand and DNA were found to modulate the catalytic performance of the hybrid catalysts. Using the optimal linker length, the quadruplexes formed the (-)-enantiomer with up to 65% ee, while the duplex yielded the (+)-enantiomer with up to 62% ee. This study unveils a new and simple way to control the stereochemical outcome of a Friedel-Crafts reaction.

| S-EPMC7397069 | biostudies-literature

Biocompatibility assessment of functionalized magnetic mesoporous silica nanoparticles in human HepaRG cells

Project description:We have employed whole genome microarray expression to distinguish the effect of diversely functionalized magnetic silica nanoparticles on human HepaRG cells. Cells were exposed in vitro, and datasets of differentially expressed genes were identified for NPs versus control samples.

2017-09-23 | GSE98236 | GEO

pH-Controlled Nanoparticle Catalysts for Highly Selective Tandem Henry Reaction from Mixtures.

Project description:Nature has a remarkable ability to perform selective transformation of complex biological mixtures into desired products using enzymatic catalysts. We report the preparation of nanoparticle catalysts through molecular imprinting within cross-linked micelles. These catalysts were highly selective for their targeted substrates and could selectively hydrolyze less reactive acetals over more reactive ones even under basic conditions. Their catalytic activity and selectivity were tunable through rational postmodification of the active site. These properties enabled the nanoparticle catalysts to produce the desired β-nitro alcohol from a four-component acetal mixture in a tandem deprotection/Henry reaction that required incompatible acidic and basic catalysts in the two steps.

| S-EPMC8171280 | biostudies-literature

Synthesis of 2,3,4-Trisubstituted Thiochromanes using an Organocatalytic Enantioselective Tandem Michael-Henry Reaction.

Project description:Enantioenriched 2,3,4-trisubstituted thiochromanes have been synthesized by using a cupreine-catalyzed tandem Michael addition-Henry reaction between 2-mercaptobenzaldehydes and ?-nitrostyrenes. Good diastereoselectivities and enantioselectivities were obtained for the title compounds, which may be further improved through a single recrystallization (up to 98% de and> 99% ee).

| S-EPMC2760986 | biostudies-literature

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

Project description:Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR).

| S-EPMC3477829 | biostudies-literature

Enantioselective synthesis of bicylco[3.2.1]octan-8-ones using a tandem Michael-Henry reaction.

Project description:Bicyclo[3.2.1]octan-8-ones have been prepared from a tandem Michael-Henry reaction between cyclohexane-1,2-diones and nitroalkenes using a quinine-derived thiourea as the catalyst. Although four stereogenic centers were created during the reaction, only two diastereomers were obtained in good diastereoselectivity and high enantioselectivity (92-99% ee). When 3-methylcyclohexane-1,2-dione (R(1) = Me) was used as the substrate, only the regioisomeric product of the corresponding thermodynamic enolate was obtained.

| S-EPMC2880813 | biostudies-literature

Wealth from waste: M. acuminata peel waste-derived magnetic nanoparticles as a solid catalyst for the Henry reaction.

Project description:Biosynthesis of nanoparticles by exploiting different plant materials has become a matter of great interest in recent years and is considered as a green technology as it does not involve any harmful and toxic chemicals in the synthetic procedure. In this paper, we report a novel one-pot M. acuminata peel ash extract mediated bio-synthesis of basic iron oxide nanoparticles (MAPAE@Fe3O4). The nanoparticles were fully characterized by different analytical techniques such as XRF, IR, XRD, XPS, SEM, TEM, VSM and TGA. The synthesized nanoparticles exhibited high basicity due to the presence of metal oxides, primarily basic K2O in the outer layer of Fe3O4 surfaces, and showed good catalytic activity for the synthesis of β-nitroalcohol via the Henry reaction at room temperature under solvent-free conditions. The catalyst was separated from the reaction medium by simply applying an external bar magnet making the process economical and less labor intensive. Furthermore, the catalyst can be reused up to the 4th cycle without much loss of its activity.

| S-EPMC9473269 | biostudies-literature

Fluorine-induced diastereodivergence discovered in an equally rare enantioselective syn-aza-Henry reaction.

Project description:Attention to the aza-Henry reaction, particularly over the past two decades, has resulted in a wide range of effective catalysts for the enantio- and diastereoselective versions, driven by the versatility of the β-amino nitroalkane products as precursors to secondary amines and vic-diamines. Despite this broad effort, syn-diastereoselective variants are exceedingly rare. We have discovered a subset of α-fluoro nitroalkane additions that are characterized by an unusual crossover in diastereoselection, often delivering the products with high selectivities. We report here a rigorous comparative analysis of non-fluorinated and α-fluoro nitroalkanes in their additions to azomethines. Both homogeneous and heterogeneous catalysis were applied to probe the possibility that this phenomenon might be more widely operative in the enantioselective additions of fluorine-substituted carbon nucleophiles. A complete correlation within four categories is described that uncovered a clear trend, while revealing a dramatic and distinct reversal of diastereoselection that would normally go undetected.

| S-EPMC8890141 | biostudies-literature

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

| S-EPMC8835054 | biostudies-literature

Catalytic enantioselective Henry reaction of α-keto esters, 2-acylpyridines and 2-acylpyridine N-oxides.

Project description:A pre-prepared Ni-PyBisulidine complex has been developed for the catalytic asymmetric Henry reaction of α-keto esters, 2-acylpyridines and 2-acylpyridine N-oxides. The corresponding β-nitro-α-hydroxy esters were obtained in good to excellent yields (up to 99%) with a high enantiomeric excess (ee) (up to 94%) with a catalyst loading of 1-2 mol%. The desired products of 2-acylpyridines and 2-acylpyridine N-oxides, which were simple methyl ketones, were obtained in medium to excellent yields (up to 94%) with medium to good ee (up to 86%) by using 2 mol% of catalyst.

| S-EPMC9078658 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data