Dataset Information

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

ABSTRACT: BACKGROUND:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r?=?0.65869, P?=?0.0014) between infectious group and control group was observed. CONCLUSIONS:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

SUBMITTER: Zhu JT

PROVIDER: S-EPMC6940084 | biostudies-literature | 2019 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Zhu Ji-Ting JT Lin Han H Wu Xuan X Li Zhi-Wen ZW Lin Ai-Yu AY

Chinese medical journal 20191201 23

<h4>Background</h4>Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Space ...[more]

PMID: 31856054

Similar Datasets

Project description:To improve our knowledge on the epidemiological status of African trypanosomiasis, better tools are required to monitor Trypanosome genotypes circulating in both mammalian hosts and tsetse fly vectors. This is important in determining the diversity of Trypanosomes and understanding how environmental factors and control efforts affect Trypanosome evolution. We present a single test approach for molecular detection of different Trypanosome species and subspecies using newly designed primers to amplify the Internal Transcribed Spacer 1 region of ribosomal RNA genes, coupled to Illumina sequencing of the amplicons. The protocol is based on Illumina's widely used 16s bacterial metagenomic analysis procedure that makes use of multiplex PCR and dual indexing. Results from analysis of wild tsetse flies collected from Zambia and Zimbabwe show that conventional methods for Trypanosome species detection based on band size comparisons on gels is not always able to accurately distinguish between T. vivax and T. godfreyi. Additionally, this approach shows increased sensitivity in the detection of Trypanosomes at species level with the exception of the Trypanozoon subgenus. We identified subspecies of T. congolense, T. simiae, T. vivax, and T. godfreyi without the need for additional tests. Results show T. congolense Kilifi subspecies is more closely related to T. simiae than to other T. congolense subspecies. This agrees with previous studies using satellite DNA and 18s RNA analysis. While current classification does not list any subspecies for T. godfreyi, we observed two distinct clusters for these species. Interestingly, sequences matching T. congolense Tsavo (now classified as T. simiae Tsavo) clusters distinctly from other T. simiae Tsavo sequences suggesting the Nannomonas group is more divergent than currently thought thus the need for better classification criteria. This method presents a simple but comprehensive way of identification of Trypanosome species and subspecies-specific using one PCR assay for molecular epidemiology of trypanosomes.

Dataset Information

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Publications

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets