Dataset Information

Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

ABSTRACT: Background:This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. Methods:Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. ? 2- and Fisher's tests were used to analyze the genotype-phenotype correlations. Results:(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). Conclusions:This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

SUBMITTER: Han Y

PROVIDER: S-EPMC7010634 | biostudies-literature | 2020

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Pathogenic <i>EDA</i> Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

Han Yang Y Wang Xiuli X Zheng Liyun L Zhu Tingting T Li Yuwei Y Hong Jiaqi J Xu Congcong C Wang Peiguang P Gao Min M

Frontiers in genetics 20200204

<h4>Background</h4>This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.<h4>Methods</h4>Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. <b>χ</b> <sup>2</sup>- and Fisher's tests were us ...[more]

PMID: 32117440

Similar Datasets

Project description:ObjectiveTo detect the ectodysplasin A (EDA) gene mutation in patients with hypohidro-tic ectodermal dysplasia (HED), and to analyze the distribution pattern of missing permanent teeth and the systemic manifestation of HED patients with EDA gene mutation.MethodsTwelve HED families were enrolled from clinic for genetic history collection, systemic physical examination and oral examination. Peripheral blood or saliva samples were collected from the probands and the family members to extract genomic DNA. PCR amplification and Sanger sequencing were utilized to detect the EDA gene variations, which were compared with the normal sequence (NM_001399.5). The functional impact of EDA gene variants was then evaluated by functional prediction of mutation, conservation analysis and protein structure prediction. The pathogenicity of each EDA gene variation was assessed according to the stan-dards and guidelines of the American College of Medical Genetics and Genomics (ACMG). The systemic phenotype and missing permanent tooth sites of HED patients with EDA gene mutations were summarized, and the missing rate of each tooth position was analyzed and compared.ResultsEight out of twelve HED families were identified to carry EDA gene mutations, including: c.164T>C(p.Leu55Pro); c.457C>T (p.Arg153Cys); c.466C>T(p.Arg156Cys); c. 584G>A(p.Gly195Glu); c.619delG(p.Gly207Profs*73); c.673C>T(p.Pro225Ser); c.676C>T(p.Gln226*) and c.905T>G(p.Phe302Cys). Among them, c.164T>C(p.Leu55Pro); c.619delG(p.Gly207Profs*73); c.673C>T(p.Pro225Ser); c.676C>T(p.Gln226*) and c.905T>G(p.Phe302Cys) were novel mutations. The HED patients with EDA gene mutations in this study were all male. Our results showed that the average number of missing permanent teeth was 13.86±4.49, the average number of missing permanent teeth in the upper jaw was 13.14±5.76, the missing rate was 73.02%. And in the lower jaw, the average number of missing permanent teeth was 14.57±3.05, the missing rate was 80.95%. There was no significant difference in the number of missing teeth between the left and right sides of the permanent dentition (P>0.05). Specifi-cally, the maxillary lateral incisors, the maxillary second premolars and the mandibular lateral incisors were more likely to be missing, while the maxillary central incisors, the maxillary and mandibular first molars had higher possibility of persistence.ConclusionThis study detected novel EDA gene pathogenic variants and summarized the distribution pattern of missing permanent teeth of HED patients, thus enriched the variation and phenotype spectrum of EDA gene, and provided new clinical evidence for genetic diagnosis and prenatal consultation.

Dataset Information

Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

Publications

Pathogenic <i>EDA</i> Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets