Browse
Submit Data
Databases
API
Help

Dataset Information

16 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Mutational signatures: experimental design and analytical framework.

ABSTRACT: Mutational signatures provide a powerful alternative for understanding the pathophysiology of cancer. Currently, experimental efforts aimed at validating and understanding the etiologies of cancer-derived mutational signatures are underway. In this review, we highlight key aspects of mutational signature experimental design and describe the analytical framework. We suggest guidelines and quality control measures for handling whole-genome sequencing data for mutational signature analyses and discuss pitfalls in interpretation. We envision that improved next-generation sequencing technologies and molecular cell biology approaches will usher in the next generation of studies into the etiologies and mechanisms of mutational patterns uncovered in cancers.

SUBMITTER: Koh G

PROVIDER: S-EPMC7023746 | biostudies-literature | 2020 Feb

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Mutational signatures: experimental design and analytical framework.

Koh Gene G Zou Xueqing X Nik-Zainal Serena S Nik-Zainal Serena S

Genome biology 20200214 1

Mutational signatures provide a powerful alternative for understanding the pathophysiology of cancer. Currently, experimental efforts aimed at validating and understanding the etiologies of cancer-derived mutational signatures are underway. In this review, we highlight key aspects of mutational signature experimental design and describe the analytical framework. We suggest guidelines and quality control measures for handling whole-genome sequencing data for mutational signature analyses and disc ...[more]

PMID: 32059681

Similar Datasets

Experimental and Analytical Framework for "Mix-and-Read" Assays Based on Split Luciferase.

Project description:The use of immunodetection assays including the widely used enzyme-linked immunosorbent assay (ELISA) in applications such as point-of-care detection is often limited by the need for protein immobilization and multiple binding and washing steps. Here, we describe an experimental and analytical framework for the development of simple and modular "mix-and-read" enzymatic complementation assays based on split luciferase that enable sensitive detection and quantification of analytes in solution. In this assay, two engineered protein binders targeting nonoverlapping epitopes on the target analyte were each fused to nonactive fragments of luciferase to create biosensor probes. Binding proteins to two model targets, lysozyme and Sso6904, were isolated from a combinatorial library of Sso7d mutants using yeast surface display. In the presence of the analyte, probes were brought into close proximity, reconstituting enzymatic activity of luciferase and enabling detection of low picomolar concentrations of the analyte by chemiluminescence. Subsequently, we constructed an equilibrium binding model that relates binding affinities of the binding proteins for the target, assay parameters such as the concentrations of probes used, and assay performance (limit of detection and concentration range over which the target can be quantified). Overall, our experimental and analytical framework provides the foundation for the development of split luciferase assays for detection and quantification of various targets.

| S-EPMC9301641 | biostudies-literature

bigSCale: An Analytical Framework for Big-Scale Single Cell Data

Project description:Single-cell RNA sequencing significantly deepened our insights into complex tissues and latest techniques are capable to analyze ten-thousands of cells simultaneously. With bigSCale, we provide an analytical framework being scalable to analyze millions of cells, addressing challenges of future large data sets. Unlike other methods, bigSCale does not constrain data to fit an a priori-defined distribution and instead uses an accurate numerical model of noise. We evaluate the performance of bigSCale using a biological model of aberrant gene expression and simulated data sets, which underlined its speed and accuracy. We further apply bigSCale to analyze 1.3 million cells from the mouse developing forebrain. The directed down-sampling strategy identified rare populations, such as Reelin positive Cajal-Retzius neurons, for which we determined a previously not recognized heterogeneity associated to distinct differentiation stages, spatial organization and cellular function. Together, bigSCale presents a perfect solution to address future challenges of large single-cell data sets.

2018-04-15 | GSE102934 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress

Analysis framework and experimental design for evaluating synergy-driving gene expression.

Project description:The mechanisms by which genetic risk variants interact with each other, as well as environmental factors, to contribute to complex genetic disorders remain unclear. We describe in detail our recently published approach to resolve distinct additive and synergistic transcriptomic effects after combinatorial manipulation of genetic variants and/or chemical perturbagens. Although first developed for CRISPR-based perturbation studies of isogenic human induced pluripotent stem cell-derived neurons, our methodology can be broadly applied to any RNA sequencing dataset, provided that raw read counts are available. Whereas other differential expression analyses reveal the effect of individual perturbations, here we specifically query interactions between two or more perturbagens, resolving the extent of non-additive (synergistic) interactions between perturbations. We discuss the careful experimental design required to resolve synergistic effects and considerations of statistical power and how to quantify observed synergy between experiments. Additionally, we speculate on potential future applications and explore the obvious limitations of this approach. Overall, by interrogating the effect of independent factors, alone and in combination, our analytic framework and experimental design facilitate the discovery of convergence and synergy downstream of gene and/or treatment perturbations hypothesized to contribute to complex diseases. We think that this protocol can be successfully applied by any scientist with bioinformatic skills and basic proficiency in the R programming language. Our computational pipeline ( https://github.com/nadschro/synergy-analysis ) is straightforward, does not require supercomputing support and can be conducted in a single day upon completion of RNA sequencing experiments.

| S-EPMC8609447 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

A generalized framework for computational design and mutational scanning of T-cell receptor binding interfaces.

Project description:T-cell receptors (TCRs) have emerged as a new class of therapeutics, most prominently for cancer where they are the key components of new cellular therapies as well as soluble biologics. Many studies have generated high affinity TCRs in order to enhance sensitivity. Recent outcomes, however, have suggested that fine manipulation of TCR binding, with an emphasis on specificity may be more valuable than large affinity increments. Structure-guided design is ideally suited for this role, and here we studied the generality of structure-guided design as applied to TCRs. We found that a previous approach, which successfully optimized the binding of a therapeutic TCR, had poor accuracy when applied to a broader set of TCR interfaces. We thus sought to develop a more general purpose TCR design framework. After assembling a large dataset of experimental data spanning multiple interfaces, we trained a new scoring function that accounted for unique features of each interface. Together with other improvements, such as explicit inclusion of molecular flexibility, this permitted the design new affinity-enhancing mutations in multiple TCRs, including those not used in training. Our approach also captured the impacts of mutations and substitutions in the peptide/MHC ligand, and recapitulated recent findings regarding TCR specificity, indicating utility in more general mutational scanning of TCR-pMHC interfaces.

| S-EPMC5181382 | biostudies-literature

Mutational signatures in colon cancer.

Project description:ObjectiveRecently, many tumor sequencing studies have inferred and reported on mutational signatures, short nucleotide patterns at which particular somatic base substitutions appear more often. A number of signatures reflect biological processes in the patient and factors associated with cancer risk. Our goal is to infer mutational signatures appearing in colon cancer, a cancer for which environmental risk factors vary by cancer subtype, and compare the signatures to those in adult stem cells from normal colon. We also compare the mutational signatures to others in the literature.ResultsWe apply a probabilistic mutation signature model to somatic mutations previously reported for six adult normal colon stem cells and 431 colon adenocarcinomas. We infer six mutational signatures in colon cancer, four being specific to tumors with hypermutation. Just two signatures explained the majority of mutations in the small number of normal aging colon samples. All six signatures are independently identified in a series of 295 Chinese colorectal cancers.

| S-EPMC6889194 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the SubSeries listed below.

2009-06-03 | GSE14696 | GEO

Mapping small effect mutations in Saccharomyces cerevisiae: impacts of experimental design and mutational properties.

Project description:Genetic variants identified by mapping are biased toward large phenotypic effects because of methodologic challenges for detecting genetic variants with small phenotypic effects. Recently, bulk segregant analysis combined with next-generation sequencing (BSA-seq) was shown to be a powerful and cost-effective way to map small effect variants in natural populations. Here, we examine the power of BSA-seq for efficiently mapping small effect mutations isolated from a mutagenesis screen. Specifically, we determined the impact of segregant population size, intensity of phenotypic selection to collect segregants, number of mitotic generations between meiosis and sequencing, and average sequencing depth on power for mapping mutations with a range of effects on the phenotypic mean and standard deviation as well as relative fitness. We then used BSA-seq to map the mutations responsible for three ethyl methanesulfonate-induced mutant phenotypes in Saccharomyces cerevisiae. These mutants display small quantitative variation in the mean expression of a fluorescent reporter gene (-3%, +7%, and +10%). Using a genetic background with increased meiosis rate, a reliable mating type marker, and fluorescence-activated cell sorting to efficiently score large segregating populations and isolate cells with extreme phenotypes, we successfully mapped and functionally confirmed a single point mutation responsible for the mutant phenotype in all three cases. Our simulations and experimental data show that the effects of a causative site not only on the mean phenotype, but also on its standard deviation and relative fitness should be considered when mapping genetic variants in microorganisms such as yeast that require population growth steps for BSA-seq.

| S-EPMC4455770 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data