Dataset Information

Gene knockdown in malaria parasites via non-canonical RNAi.

ABSTRACT: The lack of endogenous RNAi machinery in the malaria parasite Plasmodium hampers gene annotation and hence antimalarial drug and vaccine development. Here, we engineered rodent Plasmodium berghei to express a minimal, non-canonical RNAi machinery that solely requires Argonaute 2 (Ago2) and a modified short hairpin RNA, so-called AgoshRNA. Using this strategy, we achieved robust and specific gene knockdown throughout the entire parasite life cycle. We also successfully silenced the endogenous gene perforin-like protein 2, phenocopying a full gene knockout. Transcriptionally restricting Ago2 expression to the liver stage further enabled us to perform a stage-specific gene knockout. The RNAi-competent Plasmodium lines reported here will be a valuable resource for loss-of-function phenotyping of the many uncharacterized genes of Plasmodium in low or high throughput, without the need to engineer the target gene locus. Thereby, our new strategy and transgenic Plasmodium lines will ultimately benefit the discovery of urgently needed antimalarial drug and vaccine candidates. Generally, the ability to render RNAi-negative organisms RNAi-competent by mere introduction of two components, Ago2 and AgoshRNA, is a unique paradigm that should find broad applicability in other species.

SUBMITTER: Hentzschel F

PROVIDER: S-EPMC7145648 | biostudies-literature | 2020 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Gene knockdown in malaria parasites via non-canonical RNAi.

Hentzschel Franziska F Mitesser Vera V Fraschka Sabine Anne-Kristin SA Krzikalla Daria D Carrillo Elena Herrera EH Berkhout Ben B Bártfai Richárd R Mueller Ann-Kristin AK Grimm Dirk D

Nucleic acids research 20200101 1

The lack of endogenous RNAi machinery in the malaria parasite Plasmodium hampers gene annotation and hence antimalarial drug and vaccine development. Here, we engineered rodent Plasmodium berghei to express a minimal, non-canonical RNAi machinery that solely requires Argonaute 2 (Ago2) and a modified short hairpin RNA, so-called AgoshRNA. Using this strategy, we achieved robust and specific gene knockdown throughout the entire parasite life cycle. We also successfully silenced the endogenous gen ...[more]

PMID: 31680162

Similar Datasets

Project description:The heterochromatin environment plays a central role in silencing genes associated with the malaria parasite's development, survival in the host, and transmission to the mosquito vector. However, the underlying mechanism regulating the dynamic chromatin structure is not understood yet. Here, we have uncovered that Plasmodium falciparum Rrp6, an orthologue of eukaryotic RNA exosome-associated RNase, controls the silencing of heterochromatic genes. PfRrp6 knockdown disrupted the singular expression of the GC-rich ncRNA RUF6 family, a known critical regulator of virulence gene expression, through the stabilization of the nascent transcripts. Mechanistic investigation showed that the accumulation of the multiple RUF6 ncRNAs triggered local chromatin remodeling in situ, which activated their adjacent var genes. Strikingly, chromatin isolation by RNA purification analysis (ChIRP-seq) revealed that a remarkable RUF6 ncRNA had interacted with distal heterochromatin regions directly and stimulated a global derepression effect on heterochromatic genes, including all variant gene families and the sexual commitment-associated regulator ap2-g gene. Collectively, Rrp6 appears to conduct the epigenetic surveillance of heterochromatic gene expression through controlling RUF6 levels, thereby securing antigenic variation and sexual commitment of malaria parasites during the infection of the host.IMPORTANCE Malaria remains a major public health and economic burden. The heterochromatin environment controls the silencing of genes associated with the fate of malaria parasites. Previous studies have demonstrated that a group of GC-rich ncRNAs (RUF6) is associated with the mutually exclusive expression of var genes, but the underlying mechanisms remain elusive. Here, through a series of genetic manipulation and genome-wide multiomics analysis, we have identified the plasmodial orthologue of RNA exosome-associated Rrp6 as an upstream regulator of RUF6 expression and revealed that the dysregulation of RUF6 upon Rrp6 knockdown triggered local chromatin alteration, thereby activating most heterochromatic genes via direct interaction of RUF6 and distal gene loci. This finding not only uncovered the in-depth mechanism of RUF6-mediated regulation of heterochromatic genes but also identified Rrp6 as a novel regulator of gene expression in human malaria parasites, which provides a new target for developing intervention strategies against malaria.

Project description:Plasmodium falciparum parasites proliferate within circulating red blood cells and are responsible for the deadliest form of human malaria. These parasites are exposed to numerous intrinsic and external sources that could cause DNA damage; therefore, they have evolved efficient mechanisms to protect their genome integrity and allow them to proliferate under such conditions. In higher eukaryotes, double-strand breaks rapidly lead to phosphorylation of the core histone variant H2A.X, which marks the site of damaged DNA. We show that in P. falciparum that lacks the H2A.X variant, the canonical P. falciparum H2A (PfH2A) is phosphorylated on serine 121 upon exposure to sources of DNA damage. We further demonstrate that phosphorylated PfH2A is recruited to foci of damaged chromatin shortly after exposure to sources of damage, while the nonphosphorylated PfH2A remains spread throughout the nucleoplasm. In addition, we found that PfH2A phosphorylation is dynamic and that over time, as the parasite activates the repair machinery, this phosphorylation is removed. Finally, we demonstrate that these phosphorylation dynamics could be used to establish a novel and direct DNA repair assay in P. falciparumIMPORTANCEPlasmodium falciparum is the deadliest human parasite that causes malaria when it reaches the bloodstream and begins proliferating inside red blood cells, where the parasites are particularly prone to DNA damage. The molecular mechanisms that allow these pathogens to maintain their genome integrity under such conditions are also the driving force for acquiring genome plasticity that enables them to create antigenic variation and become resistant to essentially all available drugs. However, mechanisms of DNA damage response and repair have not been extensively studied for these parasites. The paper addresses our recent discovery that P. falciparum that lacks the histone variant H2A.X phosphorylates its canonical core histone PfH2A in response to exposure to DNA damage. The process of DNA repair in Plasmodium was mostly studied indirectly. Our findings enabled us to establish a direct DNA repair assay for P. falciparum similar to assays that are widely used in model organisms.

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Dataset Information

Gene knockdown in malaria parasites via non-canonical RNAi.

Publications

Gene knockdown in malaria parasites via non-canonical RNAi.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets