Dataset Information

Novel MNX1 mutations and genotype-phenotype analysis of patients with Currarino syndrome.

ABSTRACT: BACKGROUND:Currarino syndrome (CS) is a specific complex of congenital caudal anomalies, including anorectal malformations, presacral mass and sacral anomalies. Mutations in the MNX1 gene are closely related to CS and occur in almost all familial cases and less than half of sporadic patients. We investigated the spectrum of MNX1 pathogenic variants and associated clinical features in Chinese patients with CS. RESULTS:Seventeen index patients from 16 families were recruited from 2015 to 2018. All patients were diagnosed with CS and treated at the Capital Institute of Pediatrics Affiliated Children's Hospital. Genetic testing was applied to identify mutations in CS patients and their relatives by whole-exome sequencing and Sanger sequencing. Functional verification was performed for a recurrent noncanonical splice site variant in MNX1 with a minigene splicing assay. In 17 CS patients, 14 were complete CS and 3 were mild CS. Nine variants in MNX1 were identified in 11 patients, and these included two frameshift mutations (p.Leu223Leufs*61, p.X402Serfs*70), four nonsense mutations (p.Gly42X, p.Cys88X, p.Gln24X, p.Cys241X), one missense mutation (p.Trp288Leu), one splice region variant (c.691?+?3G?>?T) and one polyalanine polymorphism (p.Ala135insAlaAla). Seven of these nine variants have never been reported. Pathogenic MNX1 mutations were found in 100% (4/4) of familial and 46% (6/13) of sporadic patients. CONCLUSION:Our study expanded the mutation spectrum of MNX1 and provided clinical and genetic analyses of seventeen CS patients from mainland China.

SUBMITTER: Han L

PROVIDER: S-EPMC7310025 | biostudies-literature | 2020 Jun

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Novel MNX1 mutations and genotype-phenotype analysis of patients with Currarino syndrome.

Han Lu L Zhang Zhen Z Wang Hui H Song Hui H Gao Qing Q Yan Yuchun Y Tao Ran R Xiao Ping P Li Long L Jiang Qian Q Li Qi Q

Orphanet journal of rare diseases 20200622 1

<h4>Background</h4>Currarino syndrome (CS) is a specific complex of congenital caudal anomalies, including anorectal malformations, presacral mass and sacral anomalies. Mutations in the MNX1 gene are closely related to CS and occur in almost all familial cases and less than half of sporadic patients. We investigated the spectrum of MNX1 pathogenic variants and associated clinical features in Chinese patients with CS.<h4>Results</h4>Seventeen index patients from 16 families were recruited from 20 ...[more]

PMID: 32571425

Similar Datasets

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30?), c.207_8 delCG (p.Cys71Hisfs?62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs?42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs?117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Project description:Beckwith-Wiedemann syndrome (BWS) is a human imprinting disorder with a variable phenotype. The major features are anterior abdominal wall defects including exomphalos (omphalocele), pre- and postnatal overgrowth, and macroglossia. Additional less frequent complications include specific developmental defects and a predisposition to embryonal tumours. BWS is genetically heterogeneous and epigenetic changes in the IGF2/H19 genes resulting in overexpression of IGF2 have been implicated in many cases. Recently germline mutations in the cyclin dependent kinase inhibitor gene CDKN1C (p57KIP2) have been reported in a variable minority of BWS patients. We have investigated a large series of familial and sporadic BWS patients for evidence of CDKN1C mutations by direct gene sequencing. A total of 70 patients with classical BWS were investigated; 54 were sporadic with no evidence of UPD and 16 were familial from seven kindreds. Novel germline CDKN1C mutations were identified in five probands, 3/7 (43%) familial cases and 2/54 (4%) sporadic cases. There was no association between germline CDKN1C mutations and IGF2 or H19 epigenotype abnormalities. The clinical phenotype of 13 BWS patients with germline CDKN1C mutations was compared to that of BWS patients with other defined types of molecular pathology. This showed a significantly higher frequency of exomphalos in the CDKN1C mutation cases (11/13) than in patients with an imprinting centre defect (associated with biallelic IGF2 expression and H19 silencing) (0/5, p<0.005) or patients with uniparental disomy (0/9, p<0.005). However, there was no association between germline CDKN1C mutations and risk of embryonal tumours. No CDKN1C mutations were identified in six non-BWS patients with overgrowth and Wilms tumour. These findings (1) show that germline CDKN1C mutations are a frequent cause of familial but not sporadic BWS, (2) suggest that CDKN1C mutations probably cause BWS independently of changes in IGF2/H19 imprinting, (3) provide evidence that aspects of the BWS phenotype may be correlated with the involvement of specific imprinted genes, and (4) link genotype-phenotype relationships in BWS and the results of murine experimental models of BWS.

Dataset Information

Novel MNX1 mutations and genotype-phenotype analysis of patients with Currarino syndrome.

Publications

Novel MNX1 mutations and genotype-phenotype analysis of patients with Currarino syndrome.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets