Browse
Submit Data
Databases
API
Help

Dataset Information

17 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Single molecule studies reveal that p53 tetramers dynamically bind response elements containing one or two half sites

ABSTRACT: The tumor suppressor protein p53 is critical for cell fate decisions, including apoptosis, senescence, and cell cycle arrest. p53 is a tetrameric transcription factor that binds DNA response elements to regulate transcription of target genes. p53 response elements consist of two decameric half-sites, and data suggest one p53 dimer in the tetramer binds to each half-site. Despite a broad literature describing p53 binding DNA, unanswered questions remain, due partly to the need for more quantitative and structural studies with full length protein. Here we describe a single molecule fluorescence system to visualize full length p53 tetramers binding DNA in real time. The data revealed a dynamic interaction in which tetrameric p53/DNA complexes assembled and disassembled without a dimer/DNA intermediate. On a wild type DNA containing two half sites, p53/DNA complexes existed in two kinetically distinct populations. p53 tetramers bound response elements containing only one half site to form a single population of complexes with reduced kinetic stability. Altering the spacing and helical phasing between two half sites affected both the population distribution of p53/DNA complexes and their kinetic stability. Our real time single molecule measurements of full length p53 tetramers binding DNA reveal the parameters that define the stability of p53/DNA complexes, and provide insight into the pathways by which those complexes assemble.

SUBMITTER: Ly E

PROVIDER: S-EPMC7528078 | biostudies-literature | 2020 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Two p53 tetramers bind one consensus DNA response element.

Project description:p53 tumor suppressor is a transcription factor that controls cell cycle and genetic integrity. In response to genotoxic stress p53 activates DNA repair, cell cycle arrest, apoptosis or senescence, which are initiated via p53 binding to its specific DNA response elements (RE). The consensus p53 DNA RE consists of two decameric palindromic half-site sequences. Crystallographic studies have demonstrated that two isolated p53 DNA-binding core domains interact with one half-site of the p53 DNA REs suggesting that one p53 tetramer is bound to one RE. However, our recent 3D cryo-EM studies showed that the full-length p53 tetramer is bound to only one half-site of RE.Here, we have used biochemical and electron microscopy (EM) methods to analyze DNA-binding of human and murine p53 tetramers to various p53 DNA REs. Our new results demonstrate that two p53 tetramers can interact sequence-specifically with one DNA RE at the same time. In particular, the EM structural analysis revealed that two p53 tetramers bind one DNA RE simultaneously with DNA positioned between them. These results demonstrate a mode different from that assumed previously for the p53-DNA interaction and suggest important biological implications on p53 activity as a transcriptional regulator of cellular response to stress.

| S-EPMC5291249 | biostudies-literature

ATP half-sites in RadA and RAD51 recombinases bind nucleotides.

Project description:Homologous recombination is essential for repair of DNA double-strand breaks. Central to this process is a family of recombinases, including archeal RadA and human RAD51, which form nucleoprotein filaments on damaged single-stranded DNA ends and facilitate their ATP-dependent repair. ATP binding and hydrolysis are dependent on the formation of a nucleoprotein filament comprising RadA/RAD51 and single-stranded DNA, with ATP bound between adjacent protomers. We demonstrate that truncated, monomeric Pyrococcus furiosus RadA and monomerised human RAD51 retain the ability to bind ATP and other nucleotides with high affinity. We present crystal structures of both apo and nucleotide-bound forms of monomeric RadA. These structures reveal that while phosphate groups are tightly bound, RadA presents a shallow, poorly defined binding surface for the nitrogenous bases of nucleotides. We suggest that RadA monomers would be constitutively bound to nucleotides in the cell and that the bound nucleotide might play a structural role in filament assembly.

| S-EPMC4856416 | biostudies-literature

Electron microscopy studies on the quaternary structure of p53 reveal different binding modes for p53 tetramers in complex with DNA.

Project description:The multidomain homotetrameric tumor suppressor p53 has two modes of binding dsDNA that are thought to be responsible for scanning and recognizing specific response elements (REs). The C termini bind nonspecifically to dsDNA. The four DNA-binding domains (DBDs) bind REs that have two symmetric 10 base-pair sequences. p53 bound to a 20-bp RE has the DBDs enveloping the DNA, which is in the center of the molecule surrounded by linker sequences to the tetramerization domain (Tet). We investigated by electron microscopy structures of p53 bound to DNA sequences consisting of a 20-bp RE with either 12 or 20 bp nonspecific extensions on either end. We found a variety of structures that give clues to recognition and scanning mechanisms. The 44- and 60-bp sequences gave rise to three and four classes of structures, respectively. One was similar to the known 20-bp structure, but the DBDs in the other classes were loosely arranged and incompatible with specific DNA recognition. Some of the complexes had density consistent with the C termini extending from Tet to the DNA, adjacent to the DBDs. Single-molecule fluorescence resonance energy transfer experiments detected the approach of the C termini towards the DBDs on addition of DNA. The structural data are consistent with p53 sliding along DNA via its C termini and the DNA-binding domains hopping on and off during searches for REs. The loose structures and posttranslational modifications account for the affinity of nonspecific DNA for p53 and point to a mechanism of enhancement of specificity by its binding to effector proteins.

| S-EPMC3021029 | biostudies-literature

Fuzzy tandem repeats containing p53 response elements may define species-specific p53 target genes.

Project description:Evolutionary forces that shape regulatory networks remain poorly understood. In mammals, the Rb pathway is a classic example of species-specific gene regulation, as a germline mutation in one Rb allele promotes retinoblastoma in humans, but not in mice. Here we show that p53 transactivates the Retinoblastoma-like 2 (Rbl2) gene to produce p130 in murine, but not human, cells. We found intronic fuzzy tandem repeats containing perfect p53 response elements to be important for this regulation. We next identified two other murine genes regulated by p53 via fuzzy tandem repeats: Ncoa1 and Klhl26. The repeats are poorly conserved in evolution, and the p53-dependent regulation of the murine genes is lost in humans. Our results indicate a role for the rapid evolution of tandem repeats in shaping differences in p53 regulatory networks between mammalian species.

| S-EPMC3386156 | biostudies-literature

Specific recognition of p53 tetramers by peptides derived from p53 interacting proteins.

Project description:Oligomerization plays a major role in regulating the activity of many proteins, and in modulating their interactions. p53 is a homotetrameric transcription factor that has a pivotal role in tumor suppression. Its tetramerization domain is contained within its C-terminal domain, which is a site for numerous protein-protein interactions. Those can either depend on or regulate p53 oligomerization. Here we screened an array of peptides derived from proteins known to bind the tetrameric p53 C-terminal domain (p53CTD) and identified ten binding peptides. We quantitatively characterized their binding to p53CTD using fluorescence anisotropy. The peptides bound tetrameric p53CTD with micromolar affinities. Despite the high charge of the binding peptides, electrostatics contributed only mildly to the interactions. NMR studies indicated that the peptides bound p53CTD at defined sites. The most significant chemical shift deviations were observed for the peptides WS100B(81-92), which bound directly to the p53 tetramerization domain, and PKC?(281-295), which stabilized p53CTD in circular dichroism thermal denaturation studies. Using analytical ultracentrifugation, we found that several of the peptides bound preferentially to p53 tetramers. Our results indicate that the protein-protein interactions of p53 are dependent on the oligomerization state of p53. We conclude that peptides may be used to regulate the oligomerization of p53.

| S-EPMC3365014 | biostudies-literature

Distinct sites on the G-actin molecule bind group-specific component and deoxyribonuclease I.

Project description:Addition of group-specific component (Gc) to G-actin with or without deoxyribonuclease I (DNAase) led to formation of binary complexes (Gc-G-actin) and ternary complexes (Gc-G-actin-DNAase) respectively. The electrophoretic mobility of ternary complexes, as shown by crossed and rocket immunoelectrophoresis, was slower than that of binary complexes, although both were faster than native Gc. In gradient polyacrylamide-gel electrophoresis, such complexes could again be resolved, apparently on the basis of relative molecular size: Gc-G-actin-DNAase (Mr approx. 131000), Gc-G-actin (Mr approx. 98000) and Gc (Mr approx. 56000). In contrast, the pI of ternary complex was indistinguishable by isoelectric focusing from that of binary complex, even though both were clearly more acidic than native Gc. The affinity of Gc for G-actin (affinity constant, Ka, 1.9 X 10(8) M-1) was not significantly altered by additional interaction with DNAase (Ka, 1.5 X 10(8)M-1), and both binary and ternary complexes still bound 25-hydroxycholecalciferol. In addition, the inhibitory effect of G-actin on DNAase activity was not discernibly affected by interaction with Gc. These results demonstrate that the various molecular forms of Gc can be distinguished by physicochemical parameters, and that Gc and DNAase bind to distinct sites on G-actin and can interact both independently and contemporaneously with this molecule.

| S-EPMC1145005 | biostudies-other

Glycosylated linkers in multimodular lignocellulose-degrading enzymes dynamically bind to cellulose.

Project description:Plant cell-wall polysaccharides represent a vast source of food in nature. To depolymerize polysaccharides to soluble sugars, many organisms use multifunctional enzyme mixtures consisting of glycoside hydrolases, lytic polysaccharide mono-oxygenases, polysaccharide lyases, and carbohydrate esterases, as well as accessory, redox-active enzymes for lignin depolymerization. Many of these enzymes that degrade lignocellulose are multimodular with carbohydrate-binding modules (CBMs) and catalytic domains connected by flexible, glycosylated linkers. These linkers have long been thought to simply serve as a tether between structured domains or to act in an inchworm-like fashion during catalytic action. To examine linker function, we performed molecular dynamics (MD) simulations of the Trichoderma reesei Family 6 and Family 7 cellobiohydrolases (TrCel6A and TrCel7A, respectively) bound to cellulose. During these simulations, the glycosylated linkers bind directly to cellulose, suggesting a previously unknown role in enzyme action. The prediction from the MD simulations was examined experimentally by measuring the binding affinity of the Cel7A CBM and the natively glycosylated Cel7A CBM-linker. On crystalline cellulose, the glycosylated linker enhances the binding affinity over the CBM alone by an order of magnitude. The MD simulations before and after binding of the linker also suggest that the bound linker may affect enzyme action due to significant damping in the enzyme fluctuations. Together, these results suggest that glycosylated linkers in carbohydrate-active enzymes, which are intrinsically disordered proteins in solution, aid in dynamic binding during the enzymatic deconstruction of plant cell walls.

| S-EPMC3767562 | biostudies-literature

Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

Project description:Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 ?M for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

| S-EPMC3080992 | biostudies-literature

Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: implications for therapy.

Project description:The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53-MDM2 interaction.

| S-EPMC1413632 | biostudies-literature

Two new members of the emerging KDWK family of combinatorial transcription modulators bind as a heterodimer to flexibly spaced PuCGPy half-sites.

Project description:Initially recognized as a HeLa factor essential for parvovirus DNA replication, parvovirus initiation factor (PIF) is a site-specific DNA-binding complex consisting of p96 and p79 subunits. We have cloned and sequenced the human cDNAs encoding each subunit and characterized their products expressed from recombinant baculoviruses. The p96 and p79 polypeptides have 40% amino acid identity, focused particularly within a 94-residue region containing the sequence KDWK. This motif, first described for the Drosophila homeobox activator DEAF-1, identifies an emerging group of metazoan transcriptional modulators. During viral replication, PIF critically regulates the viral nickase, but in the host cell it probably modulates transcription, since each subunit is active in promoter activation assays and the complex binds to previously described regulatory elements in the tyrosine aminotransferase and transferrin receptor promoters. Within its recognition site, PIF binds coordinately to two copies of the tetranucleotide PuCGPy, which, remarkably, can be spaced from 1 to 15 nucleotides apart, a novel flexibility that we suggest may be characteristic of the KDWK family. Such tetranucleotides are common in promoter regions, particularly in activating transcription factor/cyclic AMP response element-binding protein (ATF/CREB) and E-box motifs, suggesting that PIF may modulate the transcription of many genes.

| S-EPMC84824 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data