Browse
Submit Data
Databases
API
Help

Dataset Information

31 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Assessing regulatory features of the current transcriptional network of Saccharomyces cerevisiae.

ABSTRACT: The capacity of living cells to adapt to different environmental, sometimes adverse, conditions is achieved through differential gene expression, which in turn is controlled by a highly complex transcriptional network. We recovered the full network of transcriptional regulatory associations currently known for Saccharomyces cerevisiae, as gathered in the latest release of the YEASTRACT database. We assessed topological features of this network filtered by the kind of supporting evidence and of previously published networks. It appears that in-degree distribution, as well as motif enrichment evolve as the yeast transcriptional network is being completed. Overall, our analyses challenged some results previously published and confirmed others. These analyses further pointed towards the paucity of experimental evidence to support theories and, more generally, towards the partial knowledge of the complete network.

SUBMITTER: Monteiro PT

PROVIDER: S-EPMC7575604 | biostudies-literature | 2020 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Assessing regulatory features of the current transcriptional network of Saccharomyces cerevisiae.

Monteiro Pedro T PT Pedreira Tiago T Galocha Monica M Teixeira Miguel C MC Chaouiya Claudine C

Scientific reports 20201020 1

The capacity of living cells to adapt to different environmental, sometimes adverse, conditions is achieved through differential gene expression, which in turn is controlled by a highly complex transcriptional network. We recovered the full network of transcriptional regulatory associations currently known for Saccharomyces cerevisiae, as gathered in the latest release of the YEASTRACT database. We assessed topological features of this network filtered by the kind of supporting evidence and of p ...[more]

PMID: 33082399

Similar Datasets

Transcriptional regulatory network shapes the genome structure of Saccharomyces cerevisiae.

Project description:Among cellular processes gene transcription is central. More and more evidence is mounting that transcription is tightly connected with the spatial organization of the chromosomes. Spatial proximity of genes sharing transcriptional machinery is one of the consequences of this organization. Motivated by information on the physical relationship among genes identified via chromosomal conformation capture methods, we complement the spatial organization with the idea that genes under similar transcription factor control, but possible scattered throughout the genome, might be in physically proximity to facilitate the access of their commonly used transcription factors. Unlike the transcription factory model, "interacting" genes in our "Gene Proximity Model" are not necessarily immediate physical neighbors but are in spatial proximity. Considering the stochastic nature of TF-promoter binding, this local condensation mechanism could serve as a tie to recruit co-regulated genes to guarantee the swiftness of biological reactions. We tested this idea with a simple eukaryotic organism, Saccharomyces cerevisiae. Chromosomal interaction patterns and folding behavior generated by our model re-construct those obtained from experiments. We show that the transcriptional regulatory network has a close linkage with the genome organization in budding yeast, which is fundamental and instrumental to later studies on other more complex eukaryotes.

| S-EPMC3720752 | biostudies-literature

Topological basis of signal integration in the transcriptional-regulatory network of the yeast, Saccharomyces cerevisiae.

Project description:BackgroundSignal recognition and information processing is a fundamental cellular function, which in part involves comprehensive transcriptional regulatory (TR) mechanisms carried out in response to complex environmental signals in the context of the cell's own internal state. However, the network topological basis of developing such integrated responses remains poorly understood.ResultsBy studying the TR network of the yeast Saccharomyces cerevisiae we show that an intermediate layer of transcription factors naturally segregates into distinct subnetworks. In these topological units transcription factors are densely interlinked in a largely hierarchical manner and respond to external signals by utilizing a fraction of these subnets.ConclusionAs transcriptional regulation represents the 'slow' component of overall information processing, the identified topology suggests a model in which successive waves of transcriptional regulation originating from distinct fractions of the TR network control robust integrated responses to complex stimuli.

| S-EPMC1643839 | biostudies-literature

Unraveling condition specific gene transcriptional regulatory networks in Saccharomyces cerevisiae.

Project description:BackgroundGene expression and transcription factor (TF) binding data have been used to reveal gene transcriptional regulatory networks. Existing knowledge of gene regulation can be presented using gene connectivity networks. However, these composite connectivity networks do not specify the range of biological conditions of the activity of each link in the network.ResultsWe present a novel method that utilizes the expression and binding patterns of the neighboring nodes of each link in existing experimentally-based, literature-derived gene transcriptional regulatory networks and extend them in silico using TF-gene binding motifs and a compendium of large expression data from Saccharomyces cerevisiae. Using this method, we predict several hundreds of new transcriptional regulatory TF-gene links, along with experimental conditions in which known and predicted links become active. This approach unravels new links in the yeast gene transcriptional regulatory network by utilizing the known transcriptional regulatory interactions, and is particularly useful for breaking down the composite transcriptional regulatory network to condition specific networks.ConclusionOur methods can facilitate future binding experiments, as they can considerably help focus on the TFs that must be surveyed to understand gene regulation.(Supplemental material and the latest version of the MATLAB implementation of the United Signature Algorithm is available online at 1 or [see Additional files 1, 2, 3, 4, 5, 6, 7, 8, 9, 10]).

| S-EPMC1488875 | biostudies-literature

Modeling the regulatory network of histone acetylation in Saccharomyces cerevisiae.

Project description:Acetylation of histones plays an important role in regulating transcription. Histone acetylation is mediated partly by the recruitment of specific histone acetyltransferases (HATs) and deacetylases (HDACs) to genomic loci by transcription factors, resulting in modulation of gene expression. Although several specific interactions between transcription factors and HATs and HDACs have been elaborated in Saccharomyces cerevisiae, the full regulatory network remains uncharacterized. We have utilized a linear regression of optimized sigmoidal functions to correlate transcription factor binding patterns to the acetylation profiles of 11 lysines in the four core histones measured at all S. cerevisiae promoters. The resulting associations are combined with large-scale protein-protein interaction data sets to generate a comprehensive model that relates recruitment of specific HDACs and HATs to transcription factors and their target genes and the resulting effects on individual lysines. This model provides a broad and detailed view of the regulatory network, describing which transcription factors are most significant in regulating acetylation of specific lysines at defined promoters. We validate the model, both computationally and experimentally, to demonstrate that it yields accurate predictions of these regulatory mechanisms.

| S-EPMC2174627 | biostudies-literature

Regulatory network connecting two glucose signal transduction pathways in Saccharomyces cerevisiae.

Project description:The yeast Saccharomyces cerevisiae senses glucose, its preferred carbon source, through multiple signal transduction pathways. In one pathway, glucose represses the expression of many genes through the Mig1 transcriptional repressor, which is regulated by the Snf1 protein kinase. In another pathway, glucose induces the expression of HXT genes encoding glucose transporters through two glucose sensors on the cell surface that generate an intracellular signal that affects function of the Rgt1 transcription factor. We profiled the yeast transcriptome to determine the range of genes targeted by this second pathway. Candidate target genes were verified by testing for Rgt1 binding to their promoters by chromatin immunoprecipitation and by measuring the regulation of the expression of promoter lacZ fusions. Relatively few genes could be validated as targets of this pathway, suggesting that this pathway is primarily dedicated to regulating the expression of HXT genes. Among the genes regulated by this glucose signaling pathway are several genes involved in the glucose induction and glucose repression pathways. The Snf3/Rgt2-Rgt1 glucose induction pathway contributes to glucose repression by inducing the transcription of MIG2, which encodes a repressor of glucose-repressed genes, and regulates itself by inducing the expression of STD1, which encodes a regulator of the Rgt1 transcription factor. The Snf1-Mig1 glucose repression pathway contributes to glucose induction by repressing the expression of SNF3 and MTH1, which encodes another regulator of Rgt1, and also regulates itself by repressing the transcription of MIG1. Thus, these two glucose signaling pathways are intertwined in a regulatory network that serves to integrate the different glucose signals operating in these two pathways.

| S-EPMC329515 | biostudies-literature

A comprehensive gene regulatory network for the diauxic shift in Saccharomyces cerevisiae.

Project description:Existing machine-readable resources for large-scale gene regulatory networks usually do not provide context information characterizing the activating conditions for a regulation and how targeted genes are affected. Although this information is essentially required for data interpretation, available networks are often restricted to not condition-dependent, non-quantitative, plain binary interactions as derived from high-throughput screens. In this article, we present a comprehensive Petri net based regulatory network that controls the diauxic shift in Saccharomyces cerevisiae. For 100 specific enzymatic genes, we collected regulations from public databases as well as identified and manually curated >400 relevant scientific articles. The resulting network consists of >300 multi-input regulatory interactions providing (i) activating conditions for the regulators; (ii) semi-quantitative effects on their targets; and (iii) classification of the experimental evidence. The diauxic shift network compiles widespread distributed regulatory information and is available in an easy-to-use machine-readable form. Additionally, we developed a browsable system organizing the network into pathway maps, which allows to inspect and trace the evidence for each annotated regulation in the model.

| S-EPMC3794591 | biostudies-literature

A Hierarchical Transcriptional Regulatory Network Required for Long-Term Thermal Stress Tolerance in an Industrial <i>Saccharomyces cerevisiae</i> Strain.

Project description:Yeast cells suffer from continuous and long-term thermal stress during high-temperature ethanol fermentation. Understanding the mechanism of yeast thermotolerance is important not only for studying microbial stress biology in basic research but also for developing thermotolerant strains for industrial application. Here, we compared the effects of 23 transcription factor (TF) deletions on high-temperature ethanol fermentation and cell survival after heat shock treatment and identified three core TFs, Sin3p, Srb2p and Mig1p, that are involved in regulating the response to long-term thermotolerance. Further analyses of comparative transcriptome profiling of the core TF deletions and transcription regulatory associations revealed a hierarchical transcriptional regulatory network centered on these three TFs. This global transcriptional regulatory network provided a better understanding of the regulatory mechanism behind long-term thermal stress tolerance as well as potential targets for transcriptome engineering to improve the performance of high-temperature ethanol fermentation by an industrial Saccharomyces cerevisiae strain.

| S-EPMC8804346 | biostudies-literature

Stability analysis of the GAL regulatory network in Saccharomyces cerevisiae and Kluyveromyces lactis.

Project description:BackgroundIn the yeast Saccharomyces cerevisiae, interactions between galactose, Gal3p, Gal80p, and Gal4p determine the transcriptional status of the genes required for the galactose utilization. Increase in the cellular galactose concentration causes the galactose molecules to bind onto Gal3p which, via Gal80p, activates Gal4p, which induces the GAL3 and GAL80 gene transcription. Recently, a linear time-invariant multi-input multi-output (MIMO) model of this GAL regulatory network has been proposed; the inputs being galactose and Gal4p, and the outputs being the active Gal4p and galactose utilization. Unfortunately, this model assumes the cell culture to be homogeneous, although it is not so in practice. We overcome this drawback by including more biochemical reactions, and derive a quadratic ordinary differential equation (ODE) based model.ResultsWe show that the model, referred to above, does not exhibit bistability. We establish sufficiency conditions for the domain of attraction of an equilibrium point of our ODE model for the special case of full-state feedback controller. We observe that the GAL regulatory system of Kluyveromyces lactis exhibits an aberration of monotone nonlinearity and apply the Rantzer multipliers to establish a class of stabilizing controllers for this system.ConclusionFeedback in a GAL regulatory system can be used to enhance the cellular memory. We show that the system can be modeled as a quadratic nonlinear system for which the effect of feedback on the domain of attraction of the equilibrium point can be characterized using linear matrix inequality (LMI) conditions that are easily implementable in software. The benefit of this result is that a mathematically sound approach to the synthesis of full-state and partial-state feedback controllers to regulate the cellular memory is now possible, irrespective of the number of state-variables or parameters of interest.

| S-EPMC3009516 | biostudies-literature

Local regulatory variation in Saccharomyces cerevisiae.

Project description:Naturally occurring sequence variation that affects gene expression is an important source of phenotypic differences among individuals within a species. We and others have previously shown that such regulatory variation can occur both at the same locus as the gene whose expression it affects (local regulatory variation) and elsewhere in the genome at trans-acting factors. Here we present a detailed analysis of genome-wide local regulatory variation in Saccharomyces cerevisiae. We used genetic linkage analysis to show that nearly a quarter of all yeast genes contain local regulatory variation between two divergent strains. We measured allele-specific expression in a diploid hybrid of the two strains for 77 genes showing strong self-linkage and found that in 52%-78% of these genes, local regulatory variation acts directly in cis. We also experimentally confirmed one example in which local regulatory variation in the gene AMN1 acts in trans through a feedback loop. Genome-wide sequence analysis revealed that genes subject to local regulatory variation show increased polymorphism in the promoter regions, and that some but not all of this increase is due to polymorphisms in predicted transcription factor binding sites. Increased polymorphism was also found in the 3' untranslated regions of these genes. These findings point to the importance of cis-acting variation, but also suggest that there is a diverse set of mechanisms through which local variation can affect gene expression levels.

| S-EPMC1189075 | biostudies-literature

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

Project description:We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

| S-EPMC331174 | biostudies-other

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data