Dataset Information

Whole Exome Sequencing in Coloboma/Microphthalmia: Identification of Novel and Recurrent Variants in Seven Genes.

ABSTRACT: Coloboma and microphthalmia (C/M) are related congenital eye malformations, which can cause significant visual impairment. Molecular diagnosis is challenging as the genes associated to date with C/M account for only a small percentage of cases. Overall, the genetic cause remains unknown in up to 80% of patients. High throughput DNA sequencing technologies, including whole-exome sequencing (WES), are therefore a useful and efficient tool for genetic screening and identification of new mutations and novel genes in C/M. In this study, we analyzed the DNA of 19 patients with C/M from 15 unrelated families using singleton WES and data analysis for 307 genes of interest. We identified seven novel and one recurrent potentially disease-causing variants in CRIM1, CHD7, FAT1, PTCH1, PUF60, BRPF1, and TGFB2 in 47% of our families, three of which occurred de novo. The detection rate in patients with ocular and extraocular manifestations (67%) was higher than in patients with an isolated ocular phenotype (46%). Our study highlights the significant genetic heterogeneity in C/M cohorts and emphasizes the diagnostic power of WES for the screening of patients and families with C/M.

SUBMITTER: Haug P

PROVIDER: S-EPMC7825129 | biostudies-literature | 2021 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Whole Exome Sequencing in Coloboma/Microphthalmia: Identification of Novel and Recurrent Variants in Seven Genes.

Haug Patricia P Koller Samuel S Maggi Jordi J Lang Elena E Feil Silke S Wlodarczyk Agnès A Bähr Luzy L Steindl Katharina K Rohrbach Marianne M Gerth-Kahlert Christina C Berger Wolfgang W

Genes 20210106 1

Coloboma and microphthalmia (C/M) are related congenital eye malformations, which can cause significant visual impairment. Molecular diagnosis is challenging as the genes associated to date with C/M account for only a small percentage of cases. Overall, the genetic cause remains unknown in up to 80% of patients. High throughput DNA sequencing technologies, including whole-exome sequencing (WES), are therefore a useful and efficient tool for genetic screening and identification of new mutations a ...[more]

PMID: 33418956

Similar Datasets

Project description:Study hypothesisExome sequencing can identify genetic causes of idiopathic recurrent pregnancy loss (RPL).Study findingWe identified compound heterozygous deleterious mutations affecting DYNC2H1 and ALOX15 in two out of four families with RPL. Both genes have a role in early development. Bioinformatics analysis of all genes with rare and putatively pathogenic mutations in miscarriages and couples showed enrichment in pathways relevant to pregnancy loss, including the complement and coagulation cascades pathways.What is known alreadyNext generation sequencing (NGS) is increasingly being used to identify known and novel gene mutations in children with developmental delay and in fetuses with ultrasound-detected anomalies. In contrast, NGS is rarely used to study pregnancy loss. Chromosome microarray analysis detects putatively causative DNA copy number variants (CNVs) in ∼2% of miscarriages and CNVs of unknown significance (predominantly parental in origin) in up to 40% of miscarriages. Therefore, a large number of miscarriages still have an unknown cause.Study design, samples/materials, methodsWhole exome sequencing (WES) was performed using Illumina HiSeq 2000 platform on seven euploid miscarriages from four families with RPL. Golden Helix SVS v8.1.5 was used for data assessment and inheritance analysis for deleterious DNA variants predicted to severely disrupt protein-coding genes by introducing a frameshift, loss of the stop codon, gain of the stop codon, changes in splicing or the initial codon. Webgestalt (http://bioinfo.vanderbilt.edu/webgestalt/) was used for pathway and disease association enrichment analysis of a gene pool containing putatively pathogenic variants in miscarriages and couples in comparison to control gene pools.Main results and the role of chanceCompound heterozygous mutations in DYNC2H1 and ALOX15 were identified in miscarriages from two families with RPL. DYNC2H1 is involved in cilia biogenesis and has been associated with fetal lethality in humans. ALOX15 is expressed in placenta and its dysregulation has been associated with inflammation, placental, dysfunction, abnormal oxidative stress response and angiogenesis. The pool of putatively pathogenic single nucleotide variants (SNVs) and small insertions and deletions (indels) detected in the miscarriages showed enrichment in 'complement and coagulation cascades pathway', and 'ciliary motility disorders'. We conclude that CNVs, individual SNVs and pool of deleterious gene mutations identified by exome sequencing could contribute to RPL.Limitations, reasons for cautionThe size of our sample cohort is small. The functional effect of candidate mutations should be evaluated to determine whether the mutations are causative.Wider implications of the findingsThis is the first study to assess whether SNVs may contribute to the pathogenesis of miscarriage. Furthermore, our findings suggest that collective effect of mutations in relevant biological pathways could be implicated in RPL.Study funding and competing interestsThe study was funded by Canadian Institutes of Health Research (grant MOP 106467) and Michael Smith Foundation of Health Research Career Scholar salary award to ERS.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Whole Exome Sequencing in Coloboma/Microphthalmia: Identification of Novel and Recurrent Variants in Seven Genes.

Publications

Whole Exome Sequencing in Coloboma/Microphthalmia: Identification of Novel and Recurrent Variants in Seven Genes.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets