Browse
Submit Data
Databases
API
Help

Dataset Information

29 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Voltage Gated Sodium Channel Genes in Epilepsy: Mutations, Functional Studies, and Treatment Dimensions.

ABSTRACT: Genetic epilepsy occurs as a result of mutations in either a single gene or an interplay of different genes. These mutations have been detected in ion channel and non-ion channel genes. A noteworthy class of ion channel genes are the voltage gated sodium channels (VGSCs) that play key roles in the depolarization phase of action potentials in neurons. Of huge significance are SCN1A, SCN1B, SCN2A, SCN3A, and SCN8A genes that are highly expressed in the brain. Genomic studies have revealed inherited and de novo mutations in sodium channels that are linked to different forms of epilepsies. Due to the high frequency of sodium channel mutations in epilepsy, this review discusses the pathogenic mutations in the sodium channel genes that lead to epilepsy. In addition, it explores the functional studies on some known mutations and the clinical significance of VGSC mutations in the medical management of epilepsy. The understanding of these channel mutations may serve as a strong guide in making effective treatment decisions in patient management.

SUBMITTER: Ademuwagun IA

PROVIDER: S-EPMC8024648 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Annotation of functional impact of voltage-gated sodium channel mutations.

Project description:Voltage-gated sodium channels are pore-forming transmembrane proteins that selectively allow sodium ions to flow across the plasma membrane according to the electro-chemical gradient thus mediating the rising phase of action potentials in excitable cells and playing key roles in physiological processes such as neurotransmission, skeletal muscle contraction, heart rhythm, and pain sensation. Genetic variations in the nine human genes encoding these channels are known to cause a large range of diseases affecting the nervous and cardiac systems. Understanding the molecular effect of genetic variations is critical for elucidating the pathologic mechanisms of known variations and in predicting the effect of newly discovered ones. To this end, we have created a Web-based tool, the Ion Channels Variants Portal, which compiles all variants characterized functionally in the human sodium channel genes. This portal describes 672 variants each associated with at least one molecular or clinical phenotypic impact, for a total of 4,658 observations extracted from 264 different research articles. These data were captured as structured annotations using standardized vocabularies and ontologies, such as the Gene Ontology and the Ion Channel ElectroPhysiology Ontology. All these data are available to the scientific community via neXtProt at https://www.nextprot.org/portals/navmut.

| S-EPMC5413847 | biostudies-literature

Functional effects of two voltage-gated sodium channel mutations that cause generalized epilepsy with febrile seizures plus type 2.

Project description:Two mutations that cause generalized epilepsy with febrile seizures plus (GEFS+) have been identified previously in the SCN1A gene encoding the alpha subunit of the Na(v)1.1 voltage-gated sodium channel (Escayg et al., 2000). Both mutations change conserved residues in putative voltage-sensing S4 segments, T875M in domain II and R1648H in domain IV. Each mutation was cloned into the orthologous rat channel rNa(v)1.1, and the properties of the mutant channels were determined in the absence and presence of the beta1 subunit in Xenopus oocytes. Neither mutation significantly altered the voltage dependence of either activation or inactivation in the presence of the beta1 subunit. The most prominent effect of the T875M mutation was to enhance slow inactivation in the presence of beta1, with small effects on the kinetics of recovery from inactivation and use-dependent activity of the channel in both the presence and absence of the beta1 subunit. The most prominent effects of the R1648H mutation were to accelerate recovery from inactivation and decrease the use dependence of channel activity with and without the beta1 subunit. The DIV mutation would cause a phenotype of sodium channel hyperexcitability, whereas the DII mutation would cause a phenotype of sodium channel hypoexcitability, suggesting that either an increase or decrease in sodium channel activity can result in seizures.

| S-EPMC6762922 | biostudies-literature

Regulation of fin regeneration by a voltage-gated sodium channel

Project description:We compare the brain and fin RNA-seq profiles of wild-type and scn8ab mutant zebrafish, which exhibit locomotion and fin regeneration defects.

2022-06-09 | GSE186729 | GEO

Phosphorylation of cardiac voltage-gated sodium channel: Potential players with multiple dimensions.

Project description:Cardiomyocytes are highly coordinated cells with multiple proteins organized in micro domains. Minor changes or interference in subcellular proteins can cause major disturbances in physiology. The cardiac sodium channel (NaV 1.5) is an important determinant of correct electrical activity in cardiomyocytes which are localized at intercalated discs, T-tubules and lateral membranes in the form of a macromolecular complex with multiple interacting protein partners. The channel is tightly regulated by post-translational modifications for smooth conduction and propagation of action potentials. Among regulatory mechanisms, phosphorylation is an enzymatic and reversible process which modulates NaV 1.5 channel function by attaching phosphate groups to serine, threonine or tyrosine residues. Phosphorylation of NaV 1.5 is implicated in both normal physiological and pathological processes and is carried out by multiple kinases. In this review, we discuss and summarize recent literature about the (a) structure of NaV 1.5 channel, (b) formation and subcellular localization of NaV 1.5 channel macromolecular complex, (c) post-translational phosphorylation and regulation of NaV 1.5 channel, and (d) how these phosphorylation events of NaV 1.5 channel alter the biophysical properties and affect the channel during disease status. We expect, by reviewing these aspects will greatly improve our understanding of NaV 1.5 channel biology, physiology and pathology, which will also provide an insight into the mechanism of arrythmogenesis at molecular level.

| S-EPMC6590314 | biostudies-literature

Epilepsy-associated dysfunction in the voltage-gated neuronal sodium channel SCN1A.

Project description:Mutations in SCN1A, the gene encoding the brain voltage-gated sodium channel alpha1 subunit (NaV1.1), are associated with at least two forms of epilepsy, generalized epilepsy with febrile seizures plus (GEFS+) and severe myoclonic epilepsy of infancy (SMEI). We examined the functional properties of four GEFS+ alleles and one SMEI allele using whole-cell patch-clamp analysis of heterologously expressed recombinant human SCN1A. One previously reported GEFS+ mutation (I1656M) and an additional novel allele (R1657C), both affecting residues in a voltage-sensing S4 segment, exhibited a similar depolarizing shift in the voltage dependence of activation. Additionally, R1657C showed a 50% reduction in current density and accelerated recovery from slow inactivation. Unlike three other GEFS+ alleles that we recently characterized, neither R1657C nor I1656M gave rise to a persistent, noninactivating current. In contrast, two other GEFS+ mutations (A1685V and V1353L) and L986F, an SMEI-associated allele, exhibited complete loss of function. In conclusion, our data provide evidence for a wide spectrum of sodium channel dysfunction in familial epilepsy and demonstrate that both GEFS+ and SMEI can be associated with nonfunctional SCN1A alleles.

| S-EPMC6740520 | biostudies-literature

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

Project description:BackgroundEpilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.MethodsBlood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.ResultsWithin SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.ConclusionIn light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

| S-EPMC9367647 | biostudies-literature

Heterozygous mutations of the voltage-gated sodium channel SCN8A are associated with spike-wave discharges and absence epilepsy in mice.

Project description:In a chemical mutagenesis screen, we identified the novel Scn8a(8J) allele of the gene encoding the neuronal voltage-gated sodium channel Na(v)1.6. The missense mutation V929F in this allele alters an evolutionarily conserved residue in the pore loop of domain 2 of Na(v)1.6. Electroencephalography (EEG) revealed well-defined spike-wave discharges (SWD), the hallmark of absence epilepsy, in Scn8a(8J) heterozygotes and in heterozygotes for two classical Scn8a alleles, Scn8a(med) (null) and Scn8a(med-jo) (missense). Mouse strain background had a significant effect on SWD, with mutants on the C3HeB/FeJ strain showing a higher incidence than on C57BL/6J. The abnormal EEG patterns in heterozygous mutant mice and the influence of genetic background on SWD make SCN8A an attractive candidate gene for common human absence epilepsy, a genetically complex disorder.

| S-EPMC2667290 | biostudies-literature

Project description:Epilepsy is a disease characterized by abnormal brain activity and a predisposition to generate epileptic seizures, leading to neurobiological, cognitive, psychological, social, and economic impacts for the patient. There are several known causes for epilepsy; one of them is the malfunction of ion channels, resulting from mutations. Voltage-gated sodium channels (NaV) play an essential role in the generation and propagation of action potential, and malfunction caused by mutations can induce irregular neuronal activity. That said, several genetic variations in NaV channels have been described and associated with epilepsy. These mutations can affect channel kinetics, modifying channel activation, inactivation, recovery from inactivation, and/or the current window. Among the NaV subtypes related to epilepsy, NaV1.1 is doubtless the most relevant, with more than 1500 mutations described. Truncation and missense mutations are the most observed alterations. In addition, several studies have already related mutated NaV channels with the electrophysiological functioning of the channel, aiming to correlate with the epilepsy phenotype. The present review provides an overview of studies on epilepsy-associated mutated human NaV1.1, NaV1.2, NaV1.3, NaV1.6, and NaV1.7.

| S-EPMC7461817 | biostudies-literature

Severe deficiency of voltage-gated sodium channel NaV1.2 elevates neuronal excitability in adult mice

Project description:Scn2a encodes voltage-gated sodium channel NaV1.2, a main mediator of neuronal action potential firing. The current paradigm suggests that NaV1.2 gain-of-function variants enhance neuronal excitability resulting in epilepsy, whereas NaV1.2 deficiency impairs excitability contributing to autism. This paradigm, however, does not explain why 20~30% of patients with NaV1.2 deficiency still develop seizures. Here we report a counterintuitive finding that severe NaV1.2 deficiency results in increased neuronal excitability. Using a unique NaV1.2-deficient mouse model, we found enhanced intrinsic excitabilities of principal neurons in the prefrontal cortex and striatum, brain regions known to be involved in Scn2a-related seizures. This increased excitability is autonomous, and is reversible by the genetic restoration of Scn2a expression in adult mice. RNA-sequencing revealed that the downregulation of multiple potassium channels including KV1.1, and KV channel openers alleviated hyperexcitability of NaV1.2-deficient neurons. This unexpected neuronal hyperexcitability may serve as a cellular basis underlying NaV1.2 deficiency-related seizures.

2021-07-13 | GSE179818 | GEO

Screening for voltage-gated sodium channel interacting peptides.

Project description:The voltage-gated sodium channel (VGSC) interacting peptide is of special interest for both basic research and pharmaceutical purposes. In this study, we established a yeast-two-hybrid based strategy to detect the interaction(s) between neurotoxic peptide and the extracellular region of VGSC. Using a previously reported neurotoxin JZTX-III as a model molecule, we demonstrated that the interactions between JZTX-III and the extracellular regions of its target hNav1.5 are detectable and the detected interactions are directly related to its activity. We further applied this strategy to the screening of VGSC interacting peptides. Using the extracellular region of hNav1.5 as the bait, we identified a novel sodium channel inhibitor SSCM-1 from a random peptide library. This peptide selectively inhibits hNav1.5 currents in the whole-cell patch clamp assays. This strategy might be used for the large scale screening for target-specific interacting peptides of VGSCs or other ion channels.

| S-EPMC3972499 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data