Dataset Information

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

ABSTRACT:

Aim

To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES).

Methods

Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations.

Results

All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein.

Conclusion

A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

SUBMITTER: Rong WN

PROVIDER: S-EPMC8025160 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Background: Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is an autosomal dominant disease with a low incidence rate. Indel mutations in the forkhead box L2 (FOXL2) gene cause two types of BPES that are distinguished by the presence (type I) or absence (type II) of premature ovarian failure (POF). The purpose of this study was to identify a possible deletion in FOXL2 in Chinese families with BPES and to clarify its relationship with POF. Methods: An autosomal dominant Chinese BPES family with four generations was enrolled in this study. Peripheral venous blood was collected from all affected patients, and genomic DNA was extracted from leukocytes. The whole coding sequence and nearby 5' untranslated region (UTR) and 3'UTR of the FOXL2 gene were amplified using polymerase chain reaction (PCR) with three sets of overlapping primers, followed by sequencing analyses. The sequencing results were analysed using SeqMan software. Based on the patients' clinical manifestations and analysis of the identified indel mutation, we found that the mutation disturbed interactions between FOXL2 and the StAR gene. Furthermore, through subcellular localisation and functional studies, we observed significant mislocalisation of the mutant protein; the mutant protein was found in the cytoplasm, while the wild-type protein was found in the nucleus. Loss of function was confirmed by transcriptional activity assays, quantitative real-time PCR, and electrophoretic mobility shift assays. Results: All affected patients presented with clinical features of BPES type I, including small palpebral fissures, ptosis, telecanthus, and epicanthus inversus with POF. A novel FOXL2 heterozygous indel mutation, c.19_95del, a 77-bp deletion that disrupts FOXL2 protein structure, was identified in all affected members of the family. In addition, this indel mutation significantly increased StAR mRNA expression by disrupting the ability of the FOXL2 protein to bind to the StAR promoter and act as a repressor of this gene. Conclusions: A novel FOXL2 indel mutation was identified in Chinese families with BPES. Our results expand the spectrum of known FOXL2 mutations and provide additional insight into the structure-function relationships of the FOXL2 protein. Furthermore, this novel mutation resulted in the dysfunction of FOXL2 as a transcription factor, blocking its ability to bind to the promoter region of the StAR gene, resulting in POF in the affected patient.