TUBB3 M323V Syndrome Presents with Infantile Nystagmus.
Ontology highlight
ABSTRACT:
SUBMITTER: Jin S
PROVIDER: S-EPMC8071555 | biostudies-literature | 2021 Apr
REPOSITORIES: biostudies-literature
Publications
<i>TUBB3</i> M323V Syndrome Presents with Infantile Nystagmus.
Jin Soohwa S Park Sung-Eun SE Won Dongju D Lee Seung-Tae ST Han Sueng-Han SH Han Jinu J
Genes 20210415 4
Variants in the <i>TUBB3</i> gene, one of the tubulin-encoding genes, are known to cause congenital fibrosis of the extraocular muscles type 3 and/or malformations of cortical development. Herein, we report a case of a 6-month-old infant with c.967A>G:p.(M323V) variant in the <i>TUBB3</i> gene, who had only infantile nystagmus without other ophthalmological abnormalities. Subsequent brain magnetic resonance imaging (MRI) revealed cortical dysplasia. Neurological examinations did not reveal gross ...[more]
Similar Datasets
Project description:PurposeResearch on infantile nystagmus syndrome (INS) and velocity discrimination is limited, and no research has examined velocity discrimination in subjects with INS at their null position and away from it. This study aims to investigate how individuals with INS perform, compared with controls, when carrying out velocity discrimination tasks. Particularly, the study aims to assess how the null position affects their performance.MethodsINS subjects (N = 21, mean age 24 years; age range, 15-34 years) and controls (N = 16, mean age 26 years; age range, 22-39 years) performed horizontal and vertical velocity discrimination tasks at two gaze positions. Eighteen INS subjects were classified as idiopathic INS and three had associated visual disorders (two had oculocutaneous albinism, and one had congenital cataract). For INS subjects, testing was done at the null position and 15° away from it. If there was no null, testing was done at primary gaze position and 15° away from primary. For controls, testing was done at primary gaze position and 20° away from primary. Horizontal and vertical velocity discrimination thresholds were determined and analyzed.ResultsINS subjects showed significantly higher horizontal and vertical velocity discrimination thresholds compared with controls at both gaze positions (P < 0.001). Horizontal thresholds for INS subjects were elevated more than vertical thresholds (P < 0.0001) for INS subjects but not for controls. Within the INS group, 12 INS subjects who had an identified null position showed significantly lower horizontal and vertical thresholds at the null than at 15° away from it (P < 0.05).ConclusionsVelocity discrimination was impaired in INS subjects, with better performance at the null. These findings could assist in understanding how INS affects the daily activities of patients in tasks involving moving objects, and aid in developing new clinical visual function assessments for INS.
| S-EPMC8411855 | biostudies-literature
Project description:PurposeResearch on infantile nystagmus syndrome (INS) and motion perception is limited. We investigated how individuals with INS perform coherent motion tasks. Particularly, we assessed how the null position affects their performance.MethodsSubjects with INS and controls identified the direction of coherent motion stimuli (22 subjects with INS and 13 controls) in a two-alternative forced-choice design. For subjects with INS, testing was done at the null position and 15 degrees away from it. If there was no null, testing was done at primary gaze position and 15 degrees away from primary. For controls, testing was done at primary gaze position and 20 degrees away from primary. Horizontal and vertical motion coherence thresholds were determined.ResultsSubjects with INS showed significantly higher horizontal and vertical motion coherence thresholds compared with controls at both gaze positions (P < 0.001). Within the INS group, for 12 subjects with INS who had an identified null position, no differences in coherence thresholds were found between their null and 15 degrees away from it (P > 0.05).ConclusionsCoherent motion perception was impaired in subjects with INS. The null position did not significantly influence motion coherence thresholds for either horizontal or vertical motion.
| S-EPMC8802013 | biostudies-literature
Project description:Inherited retinal diseases (IRDs) are a clinically and genetically diverse group of progressive degenerative disorders that can result in severe visual impairment or complete blindness. Despite their predominantly monogenic inheritance patterns, the genetic complexity of over 300 identified disease-causing genes presents a significant challenge in correlating clinical phenotypes with genotypes. Achieving a molecular diagnosis is crucial for providing patients with definitive diagnostic clarity and facilitating access to emerging gene-based therapies and ongoing clinical trials. Recent advances in next-generation sequencing technologies have markedly enhanced our ability to identify genes and genetic defects leading to IRDs, thereby propelling the development of gene-based therapies. The clinical success of voretigene neparvovec (Luxturna), the first approved retinal gene therapy for RPE65-associated Leber congenital amaurosis (LCA), has spurred considerable research and development in gene-based therapies, highlighting the importance of reviewing the current status of gene therapy for IRDs, particularly those utilizing adeno-associated virus (AAV)-based therapies. As novel disease-causing mutations continue to be discovered and more targeted gene therapies are developed, integrating these treatment opportunities into the standard care for IRD patients becomes increasingly critical. This review provides an update on the diverse phenotypic-genotypic landscape of IRDs, with a specific focus on recent advances in the understanding of IRDs in children with infantile nystagmus syndrome (INS). We highlight the complexities of the genotypic-phenotypic landscape of INS-associated IRDs, including conditions such as achromatopsia, LCA, congenital stationary night blindness, and subtypes of retinitis pigmentosa. Additionally, we provide an updated overview of AAV-based gene therapies for these diseases and discuss the potential of gene-based therapies for underlying IRDs that lead to INS, offering a valuable resource for pediatric patients potentially eligible for ongoing clinical trials.
| S-EPMC11595273 | biostudies-literature
Project description:ImportanceInfantile nystagmus syndrome (INS) is a group of disorders presenting with genetic and clinical heterogeneities that have challenged the genetic and clinical diagnoses of INS. Precise molecular diagnosis in early infancy may result in more accurate genetic counseling and improved patient management.ObjectiveTo assess the accuracy of genomic data from next-generation sequencing (NGS) and phenotypic data to enhance the definitive diagnosis of INS.Design, setting, and participantsA single-center retrospective case series was conducted in 48 unrelated, consecutive patients with INS, with or without associated ocular or systemic conditions, who underwent genetic testing between June 1, 2015, and January 31, 2017. Next-generation sequencing analysis was performed using a target panel that included 113 genes associated with INS (n = 47) or a TruSight One sequencing panel that included 4813 genes associated with known human phenotypes (n = 1). Variants were filtered and prioritized by in-depth clinical review, and finally classified according to the American College of Medical Genetics and Genomics guidelines. Patients underwent a detailed ophthalmic examination, including electroretinography and optical coherence tomography, if feasible.Main outcomes and measuresDiagnostic yield of targeted NGS testing.ResultsAmong the 48 patients (21 female and 27 male; mean [SD] age at genetic testing, 9.2 [10.3] years), 8 had a family history of nystagmus and 40 were simplex. All patients were of a single ethnicity (Korean). Genetic variants that were highly likely to be causative were identified in 28 of the 48 patients, corresponding to a molecular diagnostic yield of 58.3% (95% CI, 44.4%-72.2%). FRMD7, GPR143, and PAX6 mutations appeared to be the major genetic causes of familial INS. A total of 10 patients (21%) were reclassified to a different diagnosis based on results of NGS testing, enabling accurate clinical management.Conclusions and relevanceThese findings suggest that NGS is an accurate diagnostic tool to differentiate causes of INS because diagnostic tests, such as electroretinography and optical coherence tomography, are not easily applicable in young infants. Accurate application of NGS using a standardized, stepwise, team-based approach in early childhood not only facilitated early molecular diagnosis but also led to improved personalized management in patients with INS.
| S-EPMC6583550 | biostudies-literature
Project description:PurposeTo identify the pathogenic gene of infantile nystagmus syndrome (INS) in three Chinese families and explore the potential pathogenic mechanism of FERM domain-containing 7 (FRMD7) mutations.MethodsGenetic testing was performed via Sanger sequencing. Western blotting was used to analyze protein expression of FRMD7. Glutathione S-transferase pull-down and immunoprecipitation were conducted to investigate the proteins interacting with FRMD7. Rescue assays were performed in Caenorhabditis elegans to explore the potential role of FRMD7 in vivo.ResultsWe recruited three Chinese families with X-linked INS and identified a duplication and two missense mutations in FRMD7: c.998dupA/p.His333Glnfs*2, c.580G>A/p.Ala194Thr, and c.973A>G/p.Arg325Gly (one in each family). Expression levels of three mutants were similar to that of wild-type FRMD7 in vitro. Interestingly, the mutant p.His333Glnfs*2 exhibited a predominantly nuclear location, whereas wild-type FRMD7 localized to the cytoplasm. In addition, we found FRMD7 to directly interact with the loop between transmembrane domains 3 and 4 of GABRA2, a type A gamma-aminobutyric acid (GABA) receptor (GABAARs) subunit critical for receptor transport and localization, whereas the mutants p.Ala194Thr and p.Arg325Gly exhibited decreased binding to GABRA2. In frm-3 (a nematode homologue of FRMD7) null C. elegans, we found that FRMD7 mutants exhibited a poor rescue effect on the defects of locomotion and fluorescence recovery after photobleaching of GABAARs.ConclusionsOur findings identified three FRMD7 mutants in three Chinese families with X-linked INS and confirmed GABRA2 as a novel binding partner of FRMD7. These findings suggest that FRMD7 plays an important role by targeting GABAARs.
| S-EPMC7405782 | biostudies-literature
Project description:Infantile nystagmus (IN) may result from aetiologies including albinism and FRMD7 mutations. IN has low prevalence, and twins with IN are rare. Whilst discordant presentation has been previously reported for IN, we present for the first time the comprehensive assessment of diagnostically discordant monozygotic twins. From a cohort of over 2000 patients, we identified twins and triplets discordant for nystagmus. Using next-generation sequencing, high-resolution infra-red pupil tracking and optical coherence tomography, we characterised differences in genotype and phenotype. Monozygotic twins (n = 1), dizygotic twins (n = 3) and triplets (n = 1) were included. The monozygotic twins had concordant TYR variants. No causative variants were identified in the triplets. Dizygotic twins had discordant variants in TYR, OCA2 and FRMD7. One unaffected co-twin demonstrated sub-clinical nystagmus. Foveal hypoplasia (FH) was noted in four of five probands. Both co-twins of the monozygotic pair and triplets displayed FH. In three families, at least one parent had FH without nystagmus. FH alone may be insufficient to develop nystagmus. Whilst arrested optokinetic reflex pathway development is implicated in IN, discordant twins raise questions regarding where differences in development have arisen. In unaffected monozygotes therefore, genetic variants may predispose to oculomotor instability, with variable expressivity possibly responsible for the discordance observed.
| S-EPMC7854608 | biostudies-literature
Project description:PurposeTo determine the ocular and systemic safety of using topical Lambda-Cyhalothrin (LCL) in a canine model of infantile nystagmus syndrome (INS). The rationale for this proposal is based on a case study of a patient whose INS improved after inadvertent ocular exposure to a pyrethroid pesticide containing LCL.MethodsAfter in-vitro safety testing and IUCAC approval, we studied increasing concentrations of topical LCL drops (0.002% to 0.07%) in canines with a purposely bred defect in the RPE65 gene resulting in both retinal degeneration and INS. We collected data on ocular and systemic effects and performed eye-movement recordings (EMR).ResultsAt the 0.07% concentration dose of LCL, there was minimal, reversible, conjunctival hyperemia. There was no other ocular or systemic toxicity. At the 0.06% dose, there was a visible decrease in the INS and EMR showed a 153%-240% increase in the nystagmus acuity function and a 30%-70% decrease in amplitude across gaze. There was also a 40%-60% decrease in intraocular pressure while on the drop in both eyes.ConclusionThis animal study suggests this new pharmacological agent has potential for topical treatment of both INS and diseases with raised intraocular pressure. Further, this new treatment approach confirms the importance of extraocular muscle proprioception in ocular motor diseases and their treatment.
| S-EPMC7728007 | biostudies-literature
Project description:PurposeInfantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.MethodsA total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.ResultsGenetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.ConclusionsWe discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
| S-EPMC10784212 | biostudies-literature
Project description:We describe a 3 month-old female floppy infant with hypertrophic cardiomyopathy, serum enzyme levels, which were characterized by an aspartate aminotransferase level of 144 U/l, alanine transaminase 240 U/L and creatine kinase level of 543 U/l. On the basis of the clinical signs and laboratory results, acid α-glucosidase activity was determined from dried blood spots resulting lower than the normal range (0.2 mmol/L/h: normal reference range: 1,86-21,9 mmol/L/h) and leading to a diagnosis of infantile Pompe disease. She also showed multi-directional nystagmus. Refractive errors, ptosis and strabismus are described in infantile Pompe Disease, while nystagmus is rarely reported before. Therefore with this paper we highlight an atypical ocular symptom, whose uncertain pathogenesis, to be taken into consideration, because by now, with increasing survival with ERT, new phenotypes of Pompe disease are taking shape.
| S-EPMC7716971 | biostudies-literature
Project description:Idiopathic infantile nystagmus (IIN) is an inherited disorder in which the nystagmus arises independently of any other symptoms, leading to the speculation that the disorder represents a primary defect in the area of the brain responsible for ocular motor control. The inheritance patterns are heterogeneous, however the most common form is X-linked. FRMD7 resides at Xq26-27 and approximately 50% of X-linked IIN families map to this region. Currently 45 mutations within FRMD7 have been associated with IIN, confirming the importance of FRMD7 in the pathogenesis of the disease. Although mutations in FRMD7 are known to cause IIN, very little is known about the function of the protein. FRMD7 contains a conserved N-terminal FERM domain suggesting that it may provide a link between the plasma membrane and actin cytoskeleton. Limited studies together with the knowledge of the function of other FERM domain containing proteins, suggest that FRMD7 may play a role in membrane extension during neuronal development through remodeling of the actin cytoskeleton.
| S-EPMC3163398 | biostudies-literature