Browse
Submit Data
Databases
API
Help

Dataset Information

32 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Distribution and molecular characterization of avian infectious bronchitis virus in southern China.

ABSTRACT: Avian infectious bronchitis virus (IBV) is causing considerable economic losses in the world poultry industry. The main difficulty of prevention and control of IB disease is the numerous genotypes and serotypes. The genetic analysis of IBV was mainly based on the S1 gene which played an important role in infectivity. In the study, One hundred and thirty-nine strains of avian infectious bronchitis virus were isolated from chickens showing signs of disease in southern China during the period from April 2019 to March 2020. The nucleotide and amino acid sequences from the isolated field strains were compared to 22 published references. Nucleotide homologies ranged from 64.5% to 100% and amino acid homologies ranging from 70% to 99.8%. Six genotype IBV strains were co-circulating in southern China. QX-type was still the most dominant genotype. Alignment of nucleotide and amino acid sequences of S1 gene revealed that the substitutions, insertions and deletions are widely among isolated strains. Recombination analysis showed that there is a large number of recombinant strains amongst these isolates, forming new sub branches, subtypes and variants. Therefore, long-term continuing surveillance is necessary for IBV prevention and control.

SUBMITTER: Lian J

PROVIDER: S-EPMC8192861 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Epidemiology and immunoprotection of nephropathogenic avian infectious bronchitis virus in southern China.

Project description:BACKGROUND: In last three years, 96 suspected poultry farms from different provinces in China were diagnosed for avian infectious bronchitis (IB) survey. Finally, 221 IBV strains were confirmed by dwarf embryo test and RT-PCR assay. By virus recovery trials, 187 of the isolates caused the birds died or distressed from nephritis, which was accordant with the clinical record. RESULTS: Based on epidemiology analysis of recent field isolates of nephropathogenic IB in vaccinated farms in China, YL6 strain were used for vaccination and evaluated by antibody titer and challenge tests. The immunoprotection test indicated that the practical application of vaccine based on the recent field strains could finely facilitate controlling the nephropathogenic IB. CONCLUSIONS: Our study was aim at setting a guide for safeguard against nephropathogenic IBV-caused disease in China.

| S-EPMC3212842 | biostudies-literature

Epidemiology and characterization of avian infectious bronchitis virus strains circulating in southern China during the period from 2013-2015.

Project description:Two hundred and six strains of avian infectious bronchitis virus (IBV) were isolated from chickens showing signs of disease in southern China during the period from 2013-2015. The nucleotide and amino acid sequences from the isolated field strains were compared to 42 published references. Nucleotide homologies ranged from 63.1-99.9% and amino acid homologies ranging from 60.2-100%. At least seven IBV genotypes were co-circulating in commercial chicken farms in southern China. The IBV isolates were genetically diverse and underwent continuing evolution. The QX-type, TW I-type, and 4/91-type were the most common genotypes during the three-year observation period and accounted for 88.8% of the isolated strains. Notably, the prevalence of the TW I-type strains has been increasing in recent years and has become the most common genotype in China. The emergence of variant IBV strains can be attributed to recombination. Serologic analysis and antigenic 3D cartography of 4 reference and 14 field isolated strains indicated the surveyed IBVs had diverse serology types and that the serotype of the isolated QX-type and TW I-type strains was distinct from the vaccines strains. Therefore, long-term continuing surveillance is necessary for IBV prevention and control.

| S-EPMC5529424 | biostudies-literature

Virulent avian infectious bronchitis virus, People's Republic of China.

Project description:A virulent avian infectious bronchitis virus (IBV) was isolated from 30-day-old broiler chickens that exhibited respiratory symptoms, nephropathologic lesions, and a high proportion of deaths in the People's Republic of China during 2005. The strain, designated YN, was genetically and pathologically characterized. Phylogenetic analysis showed that YN and most of the previously characterized IBV isolates found in China were phylogenetically classified into 2 main genetic clusters. The YN isolate caused severe lesions and resulted in deaths of 65% in experimental infections of 30-day-old specific-pathogen-free chickens. Tracheal and severe kidney lesions developed in all infected birds, confirming the ability of YN strain to induce both respiratory and renal disease. IBV antigens were detected by immunohistochemical analysis in the trachea, lung, kidney, and bursa, consistent with histopathologic observations, virus isolation, and reverse transcription PCR detection. We showed that YN IBV exhibits severe pathogenicity in chickens, and that similar viruses are prevalent in China.

| S-EPMC3557894 | biostudies-literature

Avian Infectious Bronchitis Virus

Project description:Avian infectious bronchitis (IB) is caused by avian infectious bronchitis virus (IBV) belonging to Coronaviridae family. The disease is prevalent in all countries with almost 100% incidence rate. Chicken and commercially reared pheasant are the natural host for IBV. Virus causes respiratory diseases, poor weight gain, feed efficiency in broiler, damage to oviduct, and abnormal egg production in mature hens resulting in economic losses. IBV also replicates in tracheal and renal epithelial cells leading to prominent tracheal and kidney lesions. Virus undergoes spontaneous mutation leading to continual emergence of new variants. The effectiveness of immunization program is diminished because of poor cross-protection among the serotypes. Identification of circulating serotypes is important in controlling IBV infection. Toll-like receptor 3 (TLR3) and TLR21 are involved in early recognition of virus resulting in induction of inflammatory cytokines. Both humoral and cellular immune responses are important in the control of infection. Humoral immunity plays an important role in recovery and clearance of viral infection. IBV-specific cytotoxic T lymphocytes induce lysis of IBV-infected cells. Effective diagnostic tools are required at field level to identify different IBV variants. Embryonated chicken eggs are effective model for virus isolation. Identification by other specific methods like virus neutralization (VN), hemagglutination inhibition (HI), enzyme linked immunosorbent assay (ELISA), immunohistochemistry, or nucleic acid analysis or by electron microscopy is also indispensable. VN test in tracheal organ culture is the best method for antigenic typing for surveillance purposes. Continuous epidemiological surveillance, strict biosecurity measures, and vaccine effective against various serotypes are necessary for controlling IB in chickens.

| S-EPMC7120852 | biostudies-literature

Analysis of S1 gene of avian infectious bronchitis virus isolated in southern China during 2011-2012.

Project description:Sixty-two strains of avian infectious bronchitis virus (IBV) were isolated from diseased chickens at different farms in southern China during 2011-2012, and 66.1 % of the isolated strains were associated with typical nephritis. Analysis of the S1 gene sequences amplified from the 62 isolated strains together with 40 reference strains published in Genbank showed nucleotide homologies ranging from 63.5 to 99.9 % and amino acid homologies ranging from 57.9 to 100 %. Phylogenetic analysis revealed that all Chinese IBV strains were clustered into six distinct genetic groups (I-VI). Most of the isolated strains belonged to group I, and the isolation of group V strains was increased compared with an earlier period of surveillance. Current vaccine strains used in China (H120, H52, W93, and Ma5) formed the group Mass which is evolutionarily distant from Chinese isolates. Alignment of S1 amino acid sequences revealed polymorphic and diverse substitutions, insertions, and deletions, and the S1 protein of major pandemic strains contained 540 amino acids with a cleavage site sequence of HRRRR or RRF(L/S)RR. Further analysis showed that recombination events formed a new subgroup. Taken together, these findings suggest that various IBV variants were co-circulating and undergoing genetic evolution in southern China during the observation period. Therefore, long-term continuing surveillance is significantly important for prevention and control of IBV infection.

| S-EPMC7088760 | biostudies-literature

Molecular characterization of a unique variant of avian infectious bronchitis virus in Tunisia.

Project description:Avian infectious bronchitis virus (IBV) is responsible of significant economic losses for poultry industry around the world, through evolution of its pathogenicity, inadequacy of vaccines, and virus evasion. Such evasion is related to the unstable nature of its RNA, in particular the S glycoprotein encoding gene, which raises great challenges with regard to the control of the disease, along with the lack of proof reading mechanisms of the RNA polymerase. The emergence of new variants might be a reason for the endemic outbreaks that are being reported in Tunisia, in addition to poor vaccination techniques and ineffective prophylactic programs. In the present study, partial nucleotide sequences of the S1 glycoprotein gene and the 3'-untranslated region (UTR) of 2 Tunisian isolates, TN1011/16 and TN1012/16, identified in 2016, were determined. Specific mutations were found in S1 gene as well as in 3'UTR region. Phylogenetic analysis of the S1 nucleotide sequences showed that both isolates are closely related to the Algerian strains, and formed a common cluster within the genotype I. In addition, these isolates were non-recombinant ones, confirming that they are unique variants. Based on their S1 gene sequences, TN1011/16 and TN1012/16 strains were distant from the H120 vaccine strain, commercially used in Tunisia along with the variant vaccine 793B type (4/91). A comparison between nucleotide sequences of their 3'UTR region and S1 gene showed a difference in IBV classification. The obtained results have confirmed that the IBVsequence continues to drift and brings valuable information in relation with its evolution, vaccine development and better control of the disease.

| S-EPMC7107247 | biostudies-literature

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

Project description:One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

| S-EPMC7165564 | biostudies-literature

Phylogenetic distribution and predominant genotype of the avian infectious bronchitis virus in China during 2008-2009.

Project description:BACKGROUND:The nephropathogenic avian infectious bronchitis (IB) caused unprecedented economic losses to the commercial chicken industry of China in 2008-2009. To investigate the prevalence of nephropathogenic IB in China, eighty IBV isolates from different provinces during 2008-2009 were identified by dwarf embryo test and RT-PCR. RESULTS:The strains were mostly isolated in winter and spring with a wide age range of IB outbreaks, from 4 to 69 days. By the virus recovery trials, 70/80 of the strains resulted in the deaths or distresses of birds from nephritis. To learn more about the molecular evolutionary characteristics of the circulating field strains, the coding region of major spike 1 (S1) protein gene of these strains was RT-PCR amplified and sequenced. Compared to the published representative strains, nucleotides and amino acids sequence analysis indicated that the S1 genes of these strains and the reference strains displayed homologies ranging from 75.1% to 99.8% and from 73.1% to 99.8% respectively. S1 protein of the major pandemic strains contained 540 or 542 amino acids with the cleavage site of HRRRR or RRFRR. Phylogenetic analysis revealed that recent field isolates of IBV in China were mostly belonged to A2-branch (QXIBV-branch) and HN08-branch, only one isolate was belonged to Gray-branch and M41-branch respectively. Most of the 80 strains showed evolutionarily distant from vaccine strains. CONCLUSIONS:The results of this study suggested that nephropathogenic IBVs were mainly A2-like strains in China during 2008-2009.

| S-EPMC3094301 | biostudies-literature

Characterization and analysis of an infectious bronchitis virus strain isolated from southern China in 2013.

Project description:BackgroundInfectious bronchitis is a severe disease caused by infectious bronchitis virus (IBV) that affects fowl flocks worldwide. The understanding of the mechanisms involved in IBV evolution and variation would provide important theoretical basis for prevention and control of the disease in the future.MethodsIBV strain GD was isolated from southern China in 2013 and the complete genome sequencing and phylogenetic analysis were performed.ResultsThe genome of approximately 27,680 nt comprised six genes, with insertions and mutations in most of the structural genes. The S1 gene showed the highest identity to strain TW2575/98 isolated in Taiwan, and was distantly related to the H120 vaccine strain. Phylogenetic analysis showed that the S1 gene of strain GD was also related to that of TW-type strains. Recombination analysis indicated that strain GD was a chimera whose putative parental strains belonged to the QX- and TW-type subgroups.ConclusionsAn increasing number of TW-type strains have been isolated from China in recent years, which is in agreement with our findings, suggesting the emergence and increased prevalence of new TW-type strains in southern China.

| S-EPMC4784446 | biostudies-literature

Rapid detection and identification of avian infectious bronchitis virus.

Project description:A rapid and sensitive method for the detection and unambiguous typing of infectious bronchitis virus (IBV) is described. RNA was isolated from IBV-infected allantoic fluid and was transcribed into cDNA. This cDNA was amplified by the polymerase chain reaction. The polymerase chain reaction products were subsequently analyzed on an agarose gel. The presence of IBV-specific RNA in the allantoic fluid then allowed the amplification of a 438-bp DNA fragment from the nucleocapsid (N) gene. For the typing of IBV isolates, we used amplified double-stranded DNA as a template in a sequencing reaction. We report 360 bases of the N gene of 18 IBV isolates. The sequence of the N gene was different between serologically indistinguishable IBV strains and may be a valuable tool in epidemiologic studies. A phylogenetic tree that was based on the sequences obtained did not agree with trees that were based on other parts of the sequence, illustrating the high frequency of recombination between IBV strains.

| S-EPMC265000 | biostudies-other

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data