Diagnostic challenges in a CMMRD patient with a novel mutation in the PMS2 gene: a case report.
Ontology highlight
ABSTRACT: Background
Constitutional mismatch repair deficiency (CMMRD) is a rare autosomal recessive condition, which is caused by biallelic mutations in mismatch repair genes: MSH2, MLH1, MSH6, and PMS2.Case presentation
We reported a unique case of an 11-year-old Chinese girl with colorectal polyposis and café-au-lait macules who had no obvious family history of Lynch syndrome-associated tumors, followed by brain gliomas and colorectal carcinoma five years later. The diagnosis of CMMRD was based on gene sequencing analysis showing a homozygous deletion NM_00535.5:c.1577delA (p.Asp526fs) in exon 11 of the PMS2 gene. Although the patient underwent surgery and radiation therapy, and close surveillances including radiological, endoscopic and hematological screening have been recommended, she died of the exacerbation of neurological symptoms at the age of 18.Conclusions
We identified a novel homozygous deletion in the PMS2 gene in a CMMRD patient with complex clinical features.
SUBMITTER: Tan S
PROVIDER: S-EPMC8274000 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:IntroductionTuberculosis can affect any organ of the body, including the heart.Presentation of caseAn 18-year old woman presented with a multifocal tuberculosis infection involving abdominal lymph nodes, a sternotomy wound, an abscess of the abdominal wall and most notably a myocardial tuberculoma. Establishing the diagnosis of the myocardial tuberculoma was challenging mainly due to the location within the heart. Initially a diagnostic percutaneous femoral vascular catheter guided biopsy of the right atrial mass was performed, but later open surgery involving median sternotomy was needed. The patient recovered fully after surgery and nine months treatment with anti-tuberculosis drugs.DiscussionThe optimal length of treatment for myocardial tuberculoma is unknown. Medical treatment for six months might be enough regardless whether surgery is performed or not.ConclusionMyocardial tuberculoma requires culture from the infected tissue for confirmed diagnosis and might be successfully treated with anti-tuberculosis drugs only. Indications for surgery include uncertain diagnosis, poor response to medical treatment or cardiac complications.
| S-EPMC5121159 | biostudies-literature
Project description:Xeroderma pigmentosum is an autosomal recessive inherited disease. The diagnosis is essentially based on clinical findings and the family history. This genodermatosis is genetically heterogeneous; to date, nine genes have been associated to this disorder. Based on the result of many studies, xeroderma pigmentosum complementation group C is the most common form of xeroderma pigmentosum. A founder mutation in the XPC gene was reported in the Maghreb region of northern Africa. According to these findings, the Department of Medical Genetics in Rabat offers molecular diagnosis by screening for the recurrent mutation c.1643_1644delTG which represents 74% of all the probands with xeroderma pigmentosum.We describe the case of a 21-year-old Moroccan son of consanguineous parents diagnosed with xeroderma pigmentosum on the basis of sun-exposed skin abnormalities and bilateral ocular involvement. A molecular study led to the identification of a new frameshift insertion of four nucleotides in exon 9.To the best of our knowledge, this mutation has not been described. The sequencing of the ninth exon should be proposed as first line molecular analysis for all Moroccan patients with xeroderma pigmentosum.
| S-EPMC5471900 | biostudies-literature
Project description:BackgroundConstitutional mismatch repair deficiency syndrome results from bi-allelic inheritance of mutations affecting the key DNA mismatch repair genes: MLH1, MSH2, MSH6 or PMS2. Individuals with bi-allelic mutations have a dysfunctional mismatch repair system from birth; as a result, constitutional mismatch repair deficiency syndrome is characterised by early onset malignancies. Fewer than 150 cases have been reported in the literature over the past 20 years. This is the first report of the founder PMS2 mutation - NM_000535.5:c.1500del (p.Val501TrpfsTer94) in exon 11 and its associated cancers in this family.Case presentationThe proband is 30 years old and is alive today. She is of Pakistani ethnic origin and a product of consanguinity. She initially presented aged 24 with painless bleeding per-rectum from colorectal polyps and was referred to clinical genetics. Clinical examination revealed two café-au-lait lesions, lichen planus, and a dermoid cyst. Her sister had been diagnosed in childhood with an aggressive brain tumour followed by colorectal cancer. During follow up, the proband developed 37 colorectal adenomatous polyps, synchronous ovarian and endometrial adenocarcinomas, and ultimately a metachronous gastric adenocarcinoma. DNA sequencing of peripheral lymphocytes revealed a bi-allelic inheritance of the PMS2 mutation NM_000535.5:c.1500del (p.Val501TrpfsTer94) in exon 11. Ovarian tumour tissue demonstrated low microsatellite instability. To date, she has had a total abdominal hysterectomy, bilateral salpingo-oophorectomy, and a total gastrectomy. Aspirin and oestrogen-only hormone replacement therapy provide some chemoprophylaxis and manage postmenopausal symptoms, respectively. An 18-monthly colonoscopy surveillance programme has led to the excision of three high-grade dysplastic colorectal tubular adenomatous polyps. The proband's family pedigree displays multiple relatives with cancers including a likely case of 'true' Turcot syndrome.ConclusionsConstitutional mismatch repair deficiency syndrome should be considered in patients who present with early onset cancer, a strong family history of cancer, and cutaneous features resembling neurofibromatosis type I. Immunohistochemistry analysis of tumour and normal tissue is sensitive and specific for identifying patients with mismatch repair deficiency and should direct DNA sequencing of lymphocytic tissue to establish a diagnosis. Microsatellite instability status appears to be of little value in identifying patients who may have constitutional mismatch repair deficiency syndrome.
| S-EPMC5381022 | biostudies-literature
Project description:X-linked adrenoleukodystrophy (X-ALD; OMIM: 300100) is the most common peroxisomal disease caused by mutations in the ATP-binding cassette, sub-family D member 1 gene or ABCD1 (geneID: 215), the coding gene for the adrenoleukodystrophy protein (ALDP), which is an ATP-binding transport protein associated to an active transport of very long chain fatty acids (VLCFAs). Dysfunction of ALDP induces an accumulation of VLCFAs in all tissues leading to a neurodegenerative disorder that involves the nervous system white matter.In our case report, magnetic resonance imaging (MRI) as well as the high levels of VLCFAs prompted the diagnosis the X-ALD. Molecular analysis of ABCD1 gene have shown a pathogenic homozygous nonsense mutation (c.1677C?>?G; p.(Tyr559*)) in exon 7.Thus, we identified here a novel mutation in the ABCD1 gene in a Moroccan patient causing X-linked adrenoleukodystrophy.
| S-EPMC4660798 | biostudies-literature
Project description:BACKGROUND:Neonatal intrahepatic cholestasis caused by citrin deficiency (NICCD) is an autosomal recessive disorder and one of the most common inherent causes of cholestatic jaundice in Asian infants. Mutations in the SLC25A13 gene, which encodes citrin protein expressed in the liver, have been identified as the genetic cause for NICCD. CASE PRESENTATION:Here, we report a 4-month-old female with clinical features including jaundice, hyperbilirubinemia, hyperlactacidemia, and abnormal liver function. The patient was diagnosed with NICCD by differential diagnosis using genetic analysis. Mutations in 60 jaundice-related genes were tested by using amplicon sequencing, which was performed on an Ion S5XL genetic analyzer. A compound heterozygous mutation in the SLC25A13 gene was identified, consisting of a known deletion SLC25A13:c.852_855delTATG and a novel splicing mutation SLC25A13:c.1841?+?3_1841?+?4delAA. Sanger sequencing for the proband and her parents was performed to validate the result and reveal the source of mutations. CONCLUSION:A compound heterozygous mutation in the SLC25A13 gene was identified in a 4-month-old female patient with NICCD. Our data suggest that amplicon sequencing is a helpful tool for the differential diagnosis of inherited diseases with similar symptoms. Further studies of the mutation spectrum of neonatal jaundice in China are warranted.
| S-EPMC6790242 | biostudies-literature
Project description:BackgroundNeurofibromatosis type 1 is an autosomal dominant inherited disease and caused by NF1 gene mutation. Its clinical manifestations include multiple cafe´-au lait (CAL) spots, skinfold freckling, neurofibroma, bone dysplasia, learning disabilities, and an increased risk of malignancy.Methods and resultsHere, we reported a Chinese patient bearing with a novel NF1 mutation (c.2064delGGATGCAGCGG/p.Gly672AsnfsTer24) and complaining mainly about bone phenotype. Functional studies found that this novel mutation caused the damage of NF1 mRNA and protein levels, and lost the inhibition on Ras/Erk signaling.ConclusionA novel mutation in NF1 gene was identified and in vitro functional studies were performed, which provided a potential molecular mechanism to explain the bone maldevelopment of patients with neurofibromatosis type 1.
| S-EPMC8172195 | biostudies-literature
Project description:OBJECTIVE:To establish the relative importance of Salmonella enterica serovar Typhi with non-classical quinolone resistance. METHODS:Eight hundred and ninety-one isolates of S. Typhi, isolated between 2004 and 2011, were tested for antibiotic susceptibility determination using disc diffusion and E-test. The mechanisms of fluoroquinolone resistance were studied in a sub-set of the NALS (nalidixic acid susceptible) isolates by wave nucleic acid fragment analysis of PCR products from gyrA, gyrB, parC and parE and from the plasmid borne determinants: qnrA,B,S; aac(6')-Ib-cr and qepA. To assess genetic relatedness multi-locus variable number tandem repeat analysis was carried out using five loci. RESULTS:Eighty isolates with a nalidixic acid MIC of <32 mg/L (NALS) and a ciprofloxacin MIC of >0.064 mg/L CIPI (ciprofloxacin reduced susceptibility) were found. In 36 NALS CIPI isolates two distinct genotypes were identified when compared with 16 susceptible controls: Group B (n = 34), mutation in gyrB at codon 464, NAL MIC of 3-12 mg/L and CIP MIC of 0.064-0.5 mg/L.; and Group C, mutation in gyrA at codon 83 (n = 2) NAL MIC of 16 mg/L and CIP MIC of 0.25-0.38 mg/L. Group B isolates were found in different strain backgrounds as defined by MLVA. CONCLUSION:The use of nalidixic acid to screen for reduced susceptibility to fluoroquinolones in S. Typhi misses CIPI-NALS isolates, an established phenotype in India.
| S-EPMC5121207 | biostudies-literature
Project description:BACKGROUND: Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2) may be involved. CASE PRESENTATION: We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. CONCLUSION: To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.
| S-EPMC1764878 | biostudies-literature
Project description:BACKGROUND:Hemophagocytic lymphohistiocytosis (HLH) is a heterogeneous and potentially fatal disease that presents symptoms of persistent fever, splenomegaly and cytopenia. Primary HLH is identified as an autosomal recessive disorder with causative genes including HPLH1, PRF1, UNC13D, STX11 and STXBP2. CASE PRESENTATION:Here, we reported an 8-month-old female patient with compound heterozygosity in the UNC13D gene. The patient, who presented typical symptoms, was diagnosed with HLH based on HLH-2004 guidelines. High-throughput amplicon sequencing for the full-length exon, including a 5 bp padding region and 6 HLH-related genes, was performed to identify the pathogenic mutations in this patient. In all, 9 heterozygous variations were detected, namely, 7 nonpathogenic SNPs, one nonsense mutation (NM_199242.2:c.2206C > T, p.Gln736X), and one splicing mutation (NM_199242.2:c.2709 + 1G > A). These two mutations were considered pathogenic according to previous studies and functional prediction. A two-generation pedigree analysis based on Sanger sequencing was performed to confirm the result. CONCLUSION:Compound heterozygosity in the UNC13D gene was identified in trans and considered a causative mutation in a female patient with HLH. The nonsense mutation (NM_199242.2:c.2206C > T, p.Gln736X) was novel in cases of HLH. Our data expand the spectrum of HLH-related mutations in China and demonstrate the potential of high-throughput amplicon sequencing in the diagnosis of HLH.
| S-EPMC5963187 | biostudies-literature
Project description:BackgroundCongenital adrenal hyperplasia (CAH) resulting from steroid 11?-hydroxylase deficiency (11?-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11?-OHD in a Chinese family.Case presentationA 19-year-old Chinese man was clinically diagnosed with 11?-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11?-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother.ConclusionsA clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11?-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.
| S-EPMC6151069 | biostudies-literature