Dataset Information

Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana.

ABSTRACT: Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct -177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from -177 to -139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (^-168GAGTCACGGAGTCGCCGCTG^-149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

SUBMITTER: Elgendy AM

PROVIDER: S-EPMC8435907 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Although the regulation of vitellogenesis in insects has been mainly discussed in terms of 'classical' lipid hormones, juvenile hormone (JH), and 20-hydroxyecdysone (20E), recent data support the notion that this process must be adjusted in harmony with a nutritional input/reservoir and involvement of certain indoleamines and neuropeptides in regulation of such process. This study focuses on crosstalks among these axes, lipid hormones, monoamines, and neuropeptides in regulation of vitellogenesis in the American cockroach Periplaneta americana with novel aspects in the roles of arylalkylamine N-acetyltransferase (aaNAT), a key enzyme in indoleamine metabolism, and the enteroendocrine peptides; crustacean cardioactive peptide (CCAP) and short neuropeptide F (sNPF). Double-stranded RNA against aaNAT (dsRNAaaNAT) was injected into designated-aged females and the effects were monitored including the expressions of aaNAT itself, vitellogenin 1 and 2 (Vg1 and Vg2) and the vitellogenin receptor (VgR) mRNAs, oocyte maturation and changes in the hemolymph peptide concentrations. Effects of peptides application and 20E were also investigated. Injection of dsRNAaaNAT strongly suppressed oocyte maturation, transcription of Vg1, Vg2, VgR, and genes encoding JH acid- and farnesoate O-methyltransferases (JHAMT and FAMeT, respectively) acting in the JH biosynthetic pathway. However, it did not affect hemolymph concentrations of CCAP and sNPF. Injection of CCAP stimulated, while sNPF suppressed oocyte maturation and Vgs/VgR transcription, i.e., acting as allatomedins. Injection of CCAP promoted, while sNPF repressed ecdysteroid (20E) synthesis, particularly at the second step of Vg uptake. 20E also affected the JH biosynthetic pathway and Vg/VgR synthesis. The results revealed that on the course of vitellogenesis, JH- and 20E-mediated regulation occurs downstream to indoleamines- and peptides-mediated regulations. Intricate mutual interactions of these regulatory routes must orchestrate reproduction in this species at the highest potency.

Dataset Information

Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets