Molecular analysis of 53 Chinese families with Wilson's disease: Six novel mutations identified.
Ontology highlight
ABSTRACT: Background
Wilson's disease (WD) is a rare autosomal recessive inherited disorder that is induced by defects of the ATP7B gene and characterized by damage to the liver and nervous system caused by aberrant copper metabolism. The identification of pathogenic mutations on two homologous chromosomes has become the gold standard for the diagnosis of WD.Methods
Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) were combined to establish a genetic diagnosis for patients from 53 unrelated Chinese WD families.Results
Biallelic mutations were detected by Sanger sequencing in 50 of the probands, while single heterozygous mutations were detected in the remaining three probands. A total of 45 diverse pathogenic mutations were detected, and 6 previously unreported mutations were involved. Five asymptomatic patients were screened from 85 family members of 38 probands participating in the study.Conclusion
This study contributes to the enlargement of the mutational spectrum of the ATP7B gene among the population of China and highlights the significance of genetic testing for asymptomatic patients.
SUBMITTER: Xiao Z
PROVIDER: S-EPMC8457707 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:Wilson's disease (WD) is an autosomal recessive inherited disorder caused by mutations in the ATPase Cu(2+) transporting beta polypeptide gene (ATP7B). The detailed metabolism of copper-induced pathology in WD is still unknown. Gene mutations as well as the possible pathways involved in the ATP7B deficiency were documented. The ATP7B gene was analyzed for mutations in 18 Chinese Han families with WD by direct sequencing. Cell viability and apoptosis analysis of ATP7B small interfering RNA (siRNA)-treated human liver carcinoma (HepG2) cells were measured by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay and Hoechst 33342 staining. Finally, the expression of B-cell CLL/lymphoma 2 (BCL2), BCL2-associated X protein (BAX), sterol regulatory element binding protein 1 (SREBP1), and minichromosome maintenance protein 7 (MCM7) of ATP7B siRNA-treated cells were tested by real-time polymerase chain reaction (real-time PCR) and Western blot analysis. Twenty different mutations including four novel mutations (p.Val145Phe, p.Glu388X, p.Thr498Ser and p.Gly837X) in the ATP7B gene were identified in our families. Haplotype analysis revealed that founder effects for four mutations (p.Arg778Leu, p.Pro992Leu, p.Ile1148Thr and p.Ala1295Val) existed in these families. Transfection of HepG2 cells with ATP7B siRNA resulted in decreased mRNA expression by 86.3%, 93.1% and 90.8%, and decreased protein levels by 58.5%, 85.5% and 82.1% at 24, 48 and 72 hours, respectively (All P<0.01). In vitro study revealed that the apoptotic, cell cycle and lipid metabolism pathway may be involved in the mechanism of WD. Our results revealed that the genetic cause of 18 Chinese families with WD and ATP7B deficiency-induce apoptosis may result from imbalance in cell cycle and lipid metabolism pathway.
| S-EPMC3699604 | biostudies-literature
Project description:Choroideremia is a bilateral and progressive X-linked inherited disease characterized by widespread chorioretinal atrophy with relative sparing of the macular region. It is caused by mutations in the ubiquitously expressed CHM gene, which lead to the absence of the Rab escort protein 1 (REP-1), resulting in prenylation deficiency. Typical fundus appearances for choroideremia were found in 3 probands from three unrelated Chinese families in our study. We firstly used the targeted exome sequencing (TES) technology to detect mutations in CHM gene. Based on an established filtering strategy of data analyses, along with confirmation by co-segregation, a previously reported mutation (c.1584_1587del TGTT, p.V529Hfs*7) was identified in one family, while two novel mutations (c.227_232delinsTGTCATTTCA, p.Q76Lfs*7; c.710dupA, p.Y237_S238delinsX) were identified in the other two families. These findings not only expands the currently limited spectrum of Chinese disease-causing variants in CHM gene, but also increases our understanding of the phenotypic and genotypic correlations of choroideremia, and may potentially lead to improved genetic counseling and specific treatment for families with choroideremia as well.
| S-EPMC5064415 | biostudies-literature
Project description:Genetic alterations are a major cause of microphthalmos, while novel-related genes and mutations in microphthalmos have rarely been explored. To identify the underlying genetic defect responsible for microphthalmos eyes in two three-generation Chinese families, we screened 425 genes involved in common inherited non-syndromic eye diseases with next-generation sequencing-based target capture sequencing of the two probands of two three-generation Chinese families diagnosed with microphthalmos. Variants were filtered and analyzed to identify possible disease-causing variants before Sanger sequencing validation. We enrolled two families with microphthalmos (Family 1: microphthalmos with congenital ocular coloboma and Family 2: simple microphthalmos). Two novel heterozygous mutations, Peroxidasin (PXDN) c.3165C>T (p.Pro1055Pro) and PXDN c.2640C>G (p.Arg880Arg), were found in Family 1, and Crystallin Beta B2 (CRYBB2) c.481G>A (p.Gly161Arg) was found in Family 2, but none of the mutations were found in the unaffected individuals, who were phenotypically normal. Multiple orthologous sequence alignment (MSA) revealed that the CRYBB2 p.Gly161Arg mutation was a deleterious effect mutation. In conclusion, the three novel mutations found in our study extend our current understanding of the genetic basis of microphthalmos and provide early pre-symptomatic diagnosis and emphasize the significance of genetic diagnosis of microphthalmos.
| S-EPMC9590552 | biostudies-literature
Project description:BackgroundWilson's disease (WD) is an autosomal recessive genetic disease caused by mutations in ATP7B and characterized by copper metabolism disorders.MethodsDirect sequencing of the ATP7B gene is the most sensitive and widely used confirmatory testing method. Fourteen probands with WD and 12 family members participated in this study. The ATP7B gene was analyzed by direct sequencing.ResultsTwenty-nine different variants (27 substitutions, 1 duplication, 1 deletion) were found. Of the 23 reported variants, nine nondisease variants, 11 disease variants, one silent variant, and two variants with uncertain functions were identified. The six novel variants included c.1875T>A, c.2306T>C, c.3028A>G, c.3243G>A, c.3437_3438 delTG, and c.3903+5G>A.ConclusionThese findings will assist in the diagnosis of WD. The novel variants have enriched the WD database.
| S-EPMC6503029 | biostudies-literature
Project description:Autosomal dominant polycystic kidney disease (ADPKD) is the common hereditary kidney disease, resulting from mutations in polycystic kidney disease 1 (PKD1) and polycystic kidney disease 2 (PKD2). Clinical data and genetic features of six Chinese families including ADPKD patients were analyzed via Next generation sequencing (NGS), Sanger sequencing, and multiplex ligation-dependent probe amplification. In family A, the proband (II5) with polycystic kidney (PK), hypertension, left ventricular hypertrophy, and valvular heart disease exhibited a heterozygous nonsense mutation, c.5086C>T (p.Gln1696Ter), in PKD1 (NM_001009944). In family B, the proband (II3) with PK, polycystic liver (PL), hypertension, hypertrophy of the left ventricle and septum, valvular heart disease, chronic kidney disease (CKD) stage 5, bilateral renal calculi, and right inguinal hernia exhibited a heterozygous missense mutation, c.6695T>C (p.Phe2232Ser), in PKD1. In family C, the proband (III1) with PK, PL, seminal vesicle cyst, hypertension, CKD stage 3, hypertrophy of the left ventricle and septum, and valvular heart disease harbored a heterozygous nonsense mutation, c.662T>G (p.Leu221Ter), in PKD2 (NM_000297). In family D, the proband (III3) with PK, hypertension, and CKD stage 5 harbored a heterozygous missense mutation, c.8311G>A (p.Glu2771Lys), in PKD1. In family E, the proband (II1) with PK, PL, hypertension, and CKD stage 5 exhibited a heterozygous deletion mutation, exon15-22, in PKD1. In family F, the proband (II2) with PK, PL, CKD stage 3, hypertension, thickened interventricular septum, and valvular heart disease carried a heterozygous missense mutation, c.1649A>G (p.His550Arg), in PKD2. Thus, three novel mutation sites which are responsible for ADPKD were discovered in this study.
| S-EPMC7791523 | biostudies-literature
Project description:PurposeTo identify the genetic defect in the TACSTD2 gene that causes gelatinous drop-like corneal dystrophy (GDLD) in two unrelated consanguineous Chinese families.MethodsGenomic DNA was prepared from leukocytes of peripheral venous blood. The coding region of the TACSTD2 gene was evaluated by means of polymerase chain reaction and direct sequencing.ResultsSequencing of the TACSTD2 gene of the two probands revealed two novel homozygous frameshift mutations: c.84insG and c.480delC. The identified molecular defect cosegregates with the disease among affected members of the families and is not found in 50 unaffected controls.ConclusionsThis study reports two novel mutations in two GDLD families and expands the spectrum of mutations in TACSTD2 gene that may cause pathological corneal amyloidosis.
| S-EPMC2774463 | biostudies-literature
Project description:BackgroundThalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene.MethodsNext-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis.ResultsNGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed.ConclusionFive novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.
| S-EPMC8683637 | biostudies-literature
Project description:BackgroundHypertrophic cardiomyopathy (HCM) is one of the most common genetic cardiovascular disorders. Mutations in the MYBPC3 gene are one of the most frequent genetic causes of HCM.ObjectivesTo screen MYBPC3 gene mutations in Chinese patients with HCM, and analyze the correlation between the genotype and the phenotype.MethodsThe 35 exons of the MYBPC3 gene were amplified by polymerase chain reaction in the 11 consecutive unrelated Chinese pedigrees. The sequences of the products were analyzed and the mutation sites were determined. The clinical data of genotype-positive families were collected, and the correlation between genotype and phenotype was analyzed.ResultsTwo mutations of the MYBPC3 gene were confirmed among 11 pedigrees. A frameshift mutation (Pro459fs) was identified in exon 17 in family H8, and a splice mutation (IVS5+5G−>C) was identified in intron 5 in family H3. These two mutations were first identified in Chinese patients with familial HCM and were absent in 110 chromosomes of healthy controls. Seven known polymorphisms were found in the cohort.ConclusionsCompared with what was reported abroad, the MYBPC3 gene is a common pathogenic gene responsible for HCM in Chinese patients, and the phenotypes of these two mutations in their respective families may have their own clinical characteristics.
| S-EPMC3006099 | biostudies-literature
Project description:PurposeThere are few genetic studies and clinical descriptions of Asian patients with X-linked ocular albinism (OA1). In the present study, the mutation analysis of G protein-coupled receptor 143 gene (GPR143) and clinical characteristics were assessed in Chinese patients with OA1.MethodsSix families with OA1 were recruited from our pediatric and genetic eye clinic. Genomic DNA was prepared from venous leukocytes. The coding regions of GPR143 were amplified by polymerase chain reaction, and subsequently analyzed by direct sequencing. The variations detected were further evaluated in available family members as well as controls.ResultsMutations in GPR143 were identified in each of the six families: c.849delT (p.Val284SerfsX15); c.238_240delCTC (p.Leu80del); c.658+1G>A, c.353G>A (p.Gly118Glu); g.1103_7266del6164 (p.Gly84AlafsX65), which resulted in a deletion of exons 2 and 3; and g.25985_26546del562 (p.Gly296ValfsX26), which resulted in a deletion of exon 8. Of these six, c.353G>A is a known mutation, while the other five are novel. All affected patients had nystagmus, poor visual acuity, and foveal hypoplasia. However, hypopigmentation of the iris and fundus was very mild in these patients.ConclusionsFive novel mutations and one known mutation were identified in six Chinese families with OA1. These results expand the mutation spectrum of GPR143, and demonstrate the clinical characteristics of OA1 among the Chinese.
| S-EPMC2576482 | biostudies-literature
Project description:BACKGROUND:Wilson's disease (WND) is a rare autosomal recessive disorder. Here we have evaluated 62 WND cases (58 probands) from the Chinese Han population to expand our knowledge of ATP7B mutations and to more completely characterize WND in China. METHODS:the coding and promoter regions of the ATP7B gene were analyzed by direct sequencing in 62 Chinese patients (58 probands) with WND (male, n = 37; female, n = 25; age range, 2 ~ 61 years old). RESULTS:neurologic manifestations were associated with older age at diagnosis (p < 0.0001) and longer diagnostic delay (p < 0.0001). Age at diagnosis was also correlated with urinary copper concentration (r = 0.58, p < 0.001). Forty different mutations, including 14 novel mutations, were identified in these patients. Common mutations included p.Arg778Leu (31.9%) and p.Pro992Leu (11.2%). Homozygous p.Arg778Leu and nonsense mutation/frameshift mutations were more often associated with primary hepatic manifestations (p = 0.0286 and p = 0.0383, respectively) and higher alanine transaminase levels at diagnosis (p = 0.0361 and p = 0.0047, respectively). Nonsense mutation/frameshift mutations were also associated with lower serum ceruloplasmin (p = 0.0065). CONCLUSIONS:we identified 14 novel mutations and found that the spectrum of mutations of ATP7B in China is quite distinct from that of Western countries. The mutation type plays a role in predicting clinical manifestations. Genetic testing is a valuable tool to detect WND in young children, especially in patients younger than 8 years old. Four exons (8, 12, 13, and 16) and two mutations (p.Arg778Leu, p.Pro992Leu) should be considered high priority for cost-effective testing in China.
| S-EPMC3025937 | biostudies-literature