Response to Sodium Channel blocking Antiseizure medications and coding polymorphisms of Sodium Channel genes in Taiwanese epilepsy patients.
Ontology highlight
ABSTRACT: Background
Many antiseizure medications (ASMs) control seizures by blocking voltage-dependent sodium channels. Polymorphisms of sodium channel genes may affect the response to ASMs due to altering the effect of ASMs on blocking sodium channels.Methods
We conducted a retrospective study of epilepsy patients followed up at the Neurological Department of Kaohsiung Chang Gung Memorial Hospital, Taiwan between January 2010 and December 2018. We categorized the patients into response, partial response, and failure to sodium channel blocking ASM groups. Sodium channel blocking ASMs included phenytoin, carbamazepine, lamotrigine, oxcarbazepine, lacosamide, zonisamide, topiramate, and valproic acid. A subgroup of predominant sodium channel blocking ASMs included phenytoin, carbamazepine, lamotrigine, oxcarbazepine, and lacosamide. Associations between the response of ASMs and single-nucleotide polymorphisms of SCN1A, SCN1B, SCN2A, and SCN9A were analyzed.Results
Two hundred Taiwanese patients and 21 single-nucleotide polymorphisms among SCN1A, SCN1B, SCN2A, and SCN9A were evaluated. We found allele C of rs55742440 in SCN1B was statistically significantly associated with not achieving seizure-free with sodium channel blocking ASMs. For the predominant sodium channel blocking ASMs group, no SNPs were associated with the response of ASMs.Conclusion
Single-nucleotide polymorphism in SCN1B was associated with the response to sodium channel blocking ASMs. This highlights the possibility that beta subunits may affect the function of sodium channels and resulted in different responsiveness to ASMs.
SUBMITTER: Lin CH
PROVIDER: S-EPMC8459515 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:ObjectiveIn vitro data prompted U.S Food and Drug Administration warnings that lamotrigine, a common sodium channel modulating anti-seizure medication (NaM-ASM), could increase the risk of sudden death in patients with structural or ischaemic cardiac disease, however, its implications for Sudden Unexpected Death in Epilepsy (SUDEP) are unclear.MethodsThis retrospective, nested case-control study identified 101 sudden unexpected death in epilepsy (SUDEP) cases and 199 living epilepsy controls from Epilepsy Monitoring Units (EMUs) in Australia and the USA. Differences in proportions of lamotrigine and NaM-ASM use were compared between cases and controls at the time of admission, and survival analyses from the time of admission up to 16 years were conducted. Multivariable logistic regression and survival analyses compared each ASM subgroup adjusting for SUDEP risk factors.ResultsProportions of cases and controls prescribed lamotrigine (P = 0.166), one NaM-ASM (P = 0.80), or ≥2NaM-ASMs (P = 0.447) at EMU admission were not significantly different. Patients taking lamotrigine (adjusted hazard ratio [aHR] = 0.56; P = 0.054), one NaM-ASM (aHR = 0.8; P = 0.588) or ≥2 NaM-ASMs (aHR = 0.49; P = 0.139) at EMU admission were not at increased SUDEP risk up to 16 years following admission. Active tonic-clonic seizures at EMU admission associated with >2-fold SUDEP risk, irrespective of lamotrigine (aHR = 2.24; P = 0.031) or NaM-ASM use (aHR = 2.25; P = 0.029). Sensitivity analyses accounting for incomplete ASM data at follow-up suggest undetected changes to ASM use are unlikely to alter our results.SignificanceThis study provides additional evidence that lamotrigine and other NaM-ASMs are unlikely to be associated with an increased long-term risk of SUDEP, up to 16 years post-EMU admission.
| S-EPMC10235563 | biostudies-literature
Project description:ImportanceTolerability is a key determinant of the effectiveness of epilepsy treatment. It is important to evaluate whether the overall tolerability has improved.ObjectiveTo identify factors associated with poor tolerability of antiseizure medications (ASMs) and examine temporal changes in tolerability.Design, setting, and participantsThis was a longitudinal cohort study at a specialist clinic in Glasgow, Scotland. Patients with newly diagnosed and treated epilepsy between July 1982 and October 2012 were included from 2282 eligible individuals. They were followed up until April 2016 or death. Data analysis was completed in August 2019.ExposuresAntiseizure medications.Main outcomes and measuresUnivariable and multivariable survival analyses were performed to examine associations between potential risk factors and development of intolerable adverse effects (AEs). Intolerable AE rates of the ASMs as the initial monotherapy were compared between 3 epochs (July 1982-June 1992, July 1992-June 2002, and July 2002-April 2016).ResultsOf 1795 patients, 969 (54.0%) were male, and the median (interquartile range) age was 33 (21-50) years. A total of 3241 ASMs were prescribed during the period, of which 504 (15.6%) were discontinued within 6 months owing to intolerable AEs. Children younger than 18 years had lower intolerable AE rates than adults (vs aged 18-64 years: adjusted hazard ratio [aHR], 1.58; 95% CI, 1.07-2.32; vs aged ≥65 years: aHR, 1.90; 95% CI, 1.19-3.02) while female individuals (aHR, 1.60; 95% CI, 1.30-1.96) and those who had more than 5 pretreatment seizures (aHR, 1.24; 95% CI, 1.03-1.49) were associated with having higher risk. For each ASM trial, the risk of intolerable AEs increased with the number of previous drug withdrawals due to AEs (aHR, 1.18; 95% CI, 1.09-1.28) and the number of concomitant ASMs (aHR, 1.31; 95% CI, 1.04-1.64). The proportion of second-generation ASMs prescribed as the initial monotherapy increased from 22.3% (33 of 148) in the first epoch to 68.7% (645 of 939) in the last (P < .001). Although differences in intolerable AE rates and types of AEs were found between the ASMs, there was no difference in the overall intolerable AEs rates to the initial monotherapy across the 3 epochs (first: 10.1% [15 of 148]; second: 13.8% [98 of 708]; third: 14.0% [131 of 939]; P = .41).Conclusions and relevanceIn this cohort study, the increased use of the second-generation ASMs had not improved overall treatment tolerability. Greater effort to improve tolerability in ASM development is needed.
| S-EPMC7042855 | biostudies-literature
Project description:BackgroundEpilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.MethodsBlood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.ResultsWithin SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.ConclusionIn light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.
| S-EPMC9367647 | biostudies-literature
Project description:Background and purposeThe management of post-stroke epilepsy (PSE) should ideally include prevention of both seizure and adverse effects; however, an optimal antiseizure medications (ASM) regimen has yet been established. The purpose of this study is to assess seizure recurrence, retention, and tolerability of older-generation and newer-generation ASM for PSE.MethodsThis prospective multicenter cohort study (PROgnosis of Post-Stroke Epilepsy [PROPOSE] study) was conducted from November 2014 to September 2019 at eight hospitals. A total of 372 patients admitted and treated with ASM at discharge were recruited. Due to the non-interventional nature of the study, ASM regimen was not adjusted and followed standard hospital practices. The primary outcome was seizure recurrence in patients receiving older-generation and newer-generation ASM. The secondary outcomes were the retention and tolerability of ASM regimens.ResultsOf the 372 PSE patients with ASM at discharge (median [IQR] age, 73 [64-81] years; 139 women [37.4%]), 36 were treated with older-generation, 286 with newer-generation, and 50 with mixed-generation ASM. In older- and newer-generation ASM groups (n = 322), 98 patients (30.4%) had recurrent seizures and 91 patients (28.3%) switched ASM regimen during the follow-up (371 [347-420] days). Seizure recurrence was lower in newer-generation, compared with the older-generation, ASM (hazard ratio [HR], 0.42, 95%CI 0.27-0.70; p = .0013). ASM regimen withdrawal and change of dosages were lower in newer-generation ASM (HR, 0.34, 95% CI 0.21-0.56, p < .0001).ConclusionsNewer-generation ASM possess advantages over older-generation ASM for secondary prophylaxis of post-stroke seizures in clinical practice.
| S-EPMC8442594 | biostudies-literature
Project description:PurposeTreatment for epilepsy primarily involves antiseizure medications (ASMs), which can be characterized using the clinical data warehouse (CDW) database. In this study, we compared retention rates and time to successful treatment for various ASMs to reflect both efficacy and adverse effects in patients with newly diagnosed epilepsy.Materials and methodsWe identified newly diagnosed epilepsy patients with ASM treatment for more than 12 months using CDW of a tertiary referral hospital. Clinical characteristics were compared between groups with successful and unsuccessful treatment. Cox regression analysis was performed to evaluate independent variables of age, sex, comorbidities, and attributes of ASM regimens.ResultsOf 2515 eligible participants, 46.2% were successfully treated with the first ASM regimen, and 74.7% with all ASM regimens with the median time-to-treatment success of 14 months. Participants with second-generation ASM as the first ASM were more likely to be successfully treated with the first regimen compared to those with first-generation ASM (51.6% vs. 42.3%, p<0.001) and more successfully treated [hazard ratio (HR)=1.26; 95% confidence interval (CI): 1.15-1.39]. Overall, valproic acid was the most common ASM across a wide range of ages under 65 years, while levetiracetam in patients aged over 65 years or lamotrigine in female adult patients. Clinical factors associated with less favorable treatment outcomes included renal disease (HR=0.78; 95% CI: 0.66-0.92), liver disease (HR=0.65; 95% CI: 0.52-0.81), depression (HR=0.70; 95% CI: 0.57-0.84), and mechanical ventilation (HR=0.58; 95% CI: 0.50-0.67).ConclusionSecond-generation ASMs have the advantage of more successful treatment with fewer ASM regimen changes compared with first-generation drugs. Various comorbid conditions as well as age and sex should be considered when selecting ASMs.
| S-EPMC10827640 | biostudies-literature
Project description:Background and objectivesPathogenic variants in PRRT2, encoding for the proline-rich transmembrane protein 2, were identified as the main cause of self-limiting sporadic and familial infantile epilepsy. Reported data on treatment response to antiseizure medications (ASMs) in defined monogenic epilepsies are limited. The aim of this study was to evaluate the treatment response of ASMs in children with monogenic PRRT2-associated infantile epilepsy.MethodsA multicenter, retrospective, cross-sectional cohort study was conducted according to the Strengthening the Reporting of Observational Studies in Epidemiology criteria. Inclusion criteria were occurrence of infantile seizures and genetic diagnosis of likely pathogenic/pathogenic PRRT2 variants.ResultsTreatment response data from 52 individuals with PRRT2-associated infantile epilepsy with a total of 79 treatments (defined as each use of an ASM in an individual) were analyzed. Ninety-six percent (50/52) of all individuals received ASMs. Levetiracetam (LEV), oxcarbazepine (OXC), valproate (VPA), and phenobarbital (PB) were most frequently administered. Sodium channel blockers were used in 22 individuals and resulted in seizure freedom in all but 1 child, who showed a reduction of more than 50% in seizure frequency. By contrast, treatment with LEV was associated with worsening of seizure activity in 2/25 (8%) treatments and no effect in 10/25 (40%) of treatments. LEV was rated significantly less effective also compared with VPA and PB. The retention rate for LEV was significantly lower compared with all aforementioned ASMs. No severe adverse events were reported, and no discontinuation of treatment was reported because of side effects.DiscussionIn conclusion, a favorable effect of most ASMs, especially sodium channel blockers such as carbamezepine and OXC, was observed, whereas the efficacy and the retention rate of LEV was lower in PRRT2-associated childhood epilepsy. Tolerability in these young children was good for all ASMs reported in the cohort.Classification of evidenceThis study provides Class IV evidence that in individuals with PRRT2-associated infantile epilepsy, sodium channel blockers are associated with reduced seizure frequency but levetiracetam is not.
| S-EPMC9520344 | biostudies-literature
Project description:ObjectiveSeveral antiseizure medications (ASMs) have been approved for the treatment of focal epilepsy. However, there is a paucity of evidence on direct comparison of ASMs. We evaluated the comparative efficacy and safety of all approved add-on ASMs for the treatment of focal epilepsy using network meta-analysis.MethodsData through extensive literature search was retrieved from PubMed, Embase, Cochrane, and ClinicalTrial.gov databases using predefined search terms from inception through March 2023. PRISMA reporting guidelines (CRD42023403450) were followed in this study. Efficacy outcomes assessed were ≥50%, ≥75%, and 100% responder rates. Patient retention rate and safety outcomes such as overall treatment-emergent adverse events (TEAEs) and individual TEAEs were assessed. "Gemtc" 4.0.4 package was used to perform Bayesian analysis. Outcomes are reported as relative risks (RRs) and 95% confidence interval (CI).ResultsLiterature search retrieved 5807 studies of which, 75 studies were included in the analysis. All ASMs showed significantly higher ≥50% responder rate compared with placebo. Except the ≥75% seizure frequency reduction for zonisamide (2.23; 95% CI: 1.00-5.70) and 100% for rufinamide (2.03; 95% CI: 0.54-11.00), all other interventions showed significantly higher ≥75% and 100% responder rates compared with placebo. Among treatments, significantly higher 100% responder rate was observed with cenobamate compared to eslicarbazepine (10.71; 95% CI: 1.56-323.9) and zonisamide (10.63; 95% CI: 1.37-261.2). All ASMs showed a lower patient retention rate compared to placebo, with the least significant value observed for oxcarbazepine (0.77; 95% CI: 0.7-0.84). Levetiracetam showed a lower risk of incidence (1.0; 95%CI: 0.94-1.1; SUCRA: 0.885067) for overall TEAE compared with other medications.SignificanceAll approved ASMs were effective as add-on treatment for focal epilepsy. Of the ASMs included, cenobamate had the greatest likelihood of allowing patients to attain seizure freedom.Plain language summaryThis article compares the efficacy and safety of antiseizure medications (ASMs) currently available to neurologists in the treatment of epileptic patients. Several newer generation ASMs that have been developed may be as effective or better than the older medications. We included 75 studies in the analysis. In comparison, all drugs improved ≥50%, ≥75% and 100% responder rates compared to control, except for Zonisamide and Rufinamide in the ≥75% and 100% responder rate categories. Retention of patients undergoing treatment was lower in drugs than placebo. All drugs were tolerated, the levetiracetam showed the best tolerability. Cenobamate more likely help completely to reduce seizures.
| S-EPMC11296132 | biostudies-literature
Project description:Genetic epilepsy occurs as a result of mutations in either a single gene or an interplay of different genes. These mutations have been detected in ion channel and non-ion channel genes. A noteworthy class of ion channel genes are the voltage gated sodium channels (VGSCs) that play key roles in the depolarization phase of action potentials in neurons. Of huge significance are SCN1A, SCN1B, SCN2A, SCN3A, and SCN8A genes that are highly expressed in the brain. Genomic studies have revealed inherited and de novo mutations in sodium channels that are linked to different forms of epilepsies. Due to the high frequency of sodium channel mutations in epilepsy, this review discusses the pathogenic mutations in the sodium channel genes that lead to epilepsy. In addition, it explores the functional studies on some known mutations and the clinical significance of VGSC mutations in the medical management of epilepsy. The understanding of these channel mutations may serve as a strong guide in making effective treatment decisions in patient management.
| S-EPMC8024648 | biostudies-literature
Project description:ObjectiveTo examine the potential influence of a ketogenic diet on serum concentrations of antiseizure medications (ASMs) in children with drug resistant epilepsy.MethodsWe investigated the serum concentrations of ASMs in 25 children with drug resistant epilepsy, 2-13 years of age, treated with a classical ketogenic diet for 12 weeks. The patients were recruited from the National Centre for Epilepsy from August 15th, 2017, to January 24th, 2022. Changes in ASM serum concentrations were analyzed using a mixed effect model analysis. Significance level was set at P < 0.05 for all comparisons.ResultsThe participants used 12 different ASMs during the study. The mean number of ASMs was 2.4 (±SD 0.7). None of the participants changed the type or dose of the ASMs during the intervention period. The serum concentrations of clobazam (n = 9, P = 0.002), desmethylclobazam (n = 9, P = 0.010), and lamotrigine (n = 6, P = 0.016) decreased significantly during the dietary treatment. The analytes with the largest reduction in serum concentration after 12 weeks of dietary treatment were clobazam (mean change -38%) and desmethylclobazam (mean change -37%). We found no significant change in the serum concentrations of levetiracetam, topiramate, and valproic acid.SignificanceWe identified a significant decrease in the serum concentrations of clobazam, desmethylclobazam, and lamotrigine following a 12-week ketogenic diet intervention in children with drug resistant epilepsy. An unintended decrease in the serum concentrations of ASMs may render the patient prone to seizures. Measurements of ASM serum concentrations might be useful in patients on a ketogenic diet, especially in patients with lack of efficacy of the dietary treatment.
| S-EPMC10472394 | biostudies-literature
Project description:Background and purposeWe investigated the trends in the prescribing of antiseizure medication (ASM) over a 9-year period, and provide real-world data regarding ASM prescriptions of patients with epilepsy in South Korea.MethodsThis study used data in the Korean National Health Information Database for the period from 2009 to 2017. We included 18 oral ASMs, which were classified into older and newer ASMs based on them first becoming available on the market before or after 1991, respectively. The annual trends in ASM prescriptions were plotted over the 9-year study period, and changes in these trends were evaluated as average annual percentage changes (AAPCs) using Poisson regression. Age- and sex-stratified analyses were also conducted.ResultsOverall, the proportion of prescriptions involving polytherapy with three or more ASMs increased from 10.08% in 2009 to 10.99% in 2017 (AAPC=0.9%, p<0.001) over the 9-year study period. Among monotherapies, although valproate (VPA) was the most frequently prescribed ASM, the prescription rate of levetiracetam (LEV) steadily increased regardless of age and sex over the study period. The monotherapy prescription trends differed depending on age and sex. In the five most frequently used ASM combination regimens, the prescription rates of VPA/LEV, LEV/oxcarbazepine, and LEV/lamotrigine regimens showed increasing tendencies. In contrast, prescription rates for all combined regimens of older ASMs declined over time in all age groups.ConclusionsThis is the first epidemiological study of the changes in prescription trends for ASM in South Korea based on nationwide data from 2009 to 2017. We found progressive increases in the use of newer ASMs for both monotherapy and duotherapy, and for polytherapy with three or more ASMs over the 9-year study period.
| S-EPMC8926764 | biostudies-literature