Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

CircSLC30A7 Inhibits Hepatocellular Carcinoma Cell Proliferation via the miR-767-5p/FBXW7/NOTCH1 Axis.

ABSTRACT: Circular RNAs, noncoding RNAs, have attracted much attention in various human tumor research fields. They regulate the development of various human cancers via microRNA sponges. This study aimed to assess the molecular mechanism of circSLC30A7 in hepatocellular carcinoma (HCC). In our study, we identified that circSLC30A7 was significantly downregulated in HCC cell lines and tissues. Furthermore, gain and loss function experiments were conducted to elucidate the biological functions of circSLC30A7 in HCC cell lines. Mechanistically, circSLC30A7 sponged miR-767-5p, inhibiting the expression of its downstream protein, FBXW7. In summary, this study revealed that circSLC30A7 is an essential tumor suppressor that inhibits HCC tumorigenesis through the miR-767-5p/FBXW7/NOTCH1 axis. Taken together, circSLC30A7 reduces HCC malignancy and can be a biomarker for HCC management.

SUBMITTER: Yu X

PROVIDER: S-EPMC8526270 | biostudies-literature | 2021

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

circSLC30A7 Inhibits Hepatocellular Carcinoma Cell Proliferation via the miR-767-5p/FBXW7/NOTCH1 Axis.

Yu Xiaotian X Zhang Yun Y Jiang Chao C Zhan Feng F Shen Zhenwei Z Shen Zhenghai Z Zhang Feng F

Journal of oncology 20211012

Circular RNAs, noncoding RNAs, have attracted much attention in various human tumor research fields. They regulate the development of various human cancers via microRNA sponges. This study aimed to assess the molecular mechanism of circSLC30A7 in hepatocellular carcinoma (HCC). In our study, we identified that circSLC30A7 was significantly downregulated in HCC cell lines and tissues. Furthermore, gain and loss function experiments were conducted to elucidate the biological functions of circSLC30 ...[more]

PMID: 34675978

Similar Datasets

miR-125a-5p inhibits tumorigenesis in hepatocellular carcinoma.

Project description:Hepatocellular carcinoma (HCC) is one of the most prevalent and deadly cancers world-wide. miR-125a-5p is a tumor suppressor in HCC and other cancers, but its mechanisms of action during HCC tumorigenesis remain largely unknown. In this study, we found that miR-125a-5p expression was significantly lower in HCC tissues and cell lines than matched normal tissues and liver cells. miR-125a-5p overexpression inhibited HCC cell proliferation and induced apoptosis in vitro and in vivo, while miR-125a-5p knockdown had the opposite effects. In addition, PTPN1 and MAP3K11 were identified as targets of miR-125a-5p. Knocking down PTPN1 and MAP3K11 activated the JNK MAPK signaling pathway to suppress HCC cell proliferation and induce apoptosis. Our findings suggest that miR-125a-5p may be a useful therapeutic target for treatment of HCC patients.

| S-EPMC6781988 | biostudies-literature

Exosomal AC068768.1 enhances the proliferation, migration, and invasion of laryngeal squamous cell carcinoma through miR-139-5p/NOTCH1 axis.

Project description:ObjectiveLong non-coding RNAs (lncRNAs) are closely associated with the pathogenesis of laryngeal squamous cell carcinoma (LSCC). This study aimed to investigate the roles of AC068768.1 in LSCC.MethodsExosomes were extracted by ultracentrifugation and identified by transmission electron microscopy (TEM) assay. The expression levels of mRNA and miRNA were determined by real-time quantitative polymerase chain reaction (RT-qPCR). Cellular functions were assesses through immunofluorescence, flow cytometry, colony formation, wound healing and transwell assays. Chromatin immunoprecipitation (ChIP) and luciferase assays were conducted to verify the binding of AC068768.1 by signal transducer and activator of transcription 3 (STAT3). Xenograft assays were performed to confirm the roles of AC068768.1 in LSCC, and hematoxylin-eosin (HE) staining was applied for histological analysis.ResultsLSCC cell-derived exosomes induced M2-like tumor-associated macrophages (TAM2) polarization, which promoted the proliferation, migration, and invasion of LSCCs. Knockdown of exosomal AC068768.1 inhibited M2 polarization and suppressed LSCC aggressiveness both in vitro and in vivo. Moreover, AC068768.1 sponged miR-139-5p, inducing the upregulation of neurogenic locus notch homolog protein 1 (NOTCH1). LSCCs adapted to TAM2 polarization in the tumor microenvironment via AC068768.1-mediated activation of the NOTCH1 pathway. Additionally, NOTCH1 activated STAT3.ConclusionThe AC068768.1/miR-139-5p/NOTCH1/STAT3 axis promotes the metastasis of LSCC. This finding may provide a novel target for LSCC therapy.

| S-EPMC11386030 | biostudies-literature

FAM83H-AS1/miR-485-5p/MEF2D axis facilitates proliferation, migration and invasion of hepatocellular carcinoma cells.

Project description:BackgroundAbundant evidence has manifested that long noncoding RNAs (lncRNAs) are closely implicated in human cancers, including hepatocellular carcinoma (HCC). Remarkably, lncRNA FAM83H antisense RNA 1 (FAM83H-AS1) has been reported to be a tumor-propeller in multiple cancers. However, its effect on HCC progression remains unknown.MethodsFAM83H-AS1 expression was analyzed by RT-qPCR. Colony formation, EdU, and flow cytometry as well as transwell assays were implemented to analyze the biological functions of FAM83H-AS1 on HCC progression. Luciferase reporter, RIP and RNA pull-down assays were implemented to detect the interaction among FAM83H-AS1, microRNA-485-5p (miR-485-5p), and myocyte enhancer factor 2D (MEF2D) in HCC cells.ResultsFAM83H-AS1 expression in HCC cells was markedly elevated. FAM83H-AS1 accelerated cell proliferation, migration and invasion whereas inhibiting cell apoptosis in HCC. Besides, we confirmed that FAM83H-AS1 acts as a miR-485-5p sponge in HCC cells. Additionally, MEF2D was verified to be a direct target of miR-485-5p. FAM83H-AS1 could upregulate MEF2D expression via sponging miR-485-5p. Further, rescue experiments testified that MEF2D upregulation or miR-485-5p downregulation offset the repressive effect of FAM83H-AS1 depletion on HCC cell progression.ConclusionsFAM83H-AS1 facilitates HCC malignant progression via targeting miR-485-5p/MEF2D axis, suggesting that FAM83H-AS1 may be a promising biomarker for HCC treatment in the future.

| S-EPMC8650424 | biostudies-literature

MiR-424-5p regulates cell cycle and inhibits proliferation of hepatocellular carcinoma cells by targeting E2F7.

Project description:ObjectiveThis study aims to explore the mechanism of the miR-424-5p/E2F7 axis in hepatocellular carcinoma (HCC) and provide new ideas for targeted therapy of HCC.MethodsBioinformatics analysis was used to identify the target differentially expressed miRNA in HCC and predict its target gene. qRT-PCR was employed to verify the expression of miR-424-5p and E2F7 mRNA in HCC cells. Western blot was performed to detect the effect of miR-424-5p ectopic expression on the protein expression of E2F7. CCK-8 was used to detect proliferative activity of HCC cells and flow cytometry was carried out for analyzing cell cycle distribution. Dual luciferase reporter assay was conducted to verify the direct targeting relationship between miR-424-5p and E2F7.ResultsWe observed that miR-424-5p was down-regulated in HCC cells. CCK-8 showed that overexpression of miR-424-5p inhibited cell proliferation, and flow cytometry showed that miR-424-5p could block cells in G0/G1 phase. E2F7 was up-regulated in HCC cells, and E2F7 overexpression could facilitate the proliferative ability of HCC cells and promote the cell cycle progressing from G0/G1 to S phase. Furthermore, dual-luciferase reporter assay indicated that miR-424-5p could directly down-regulate E2F7 expression. Analysis on cell function demonstrated that miR-424-5p inhibited the proliferation of HCC cells and blocked cell cycle at G0/G1 phase by targeting E2F7.ConclusionOur results proved that E2F7 was a direct target of miR-424-5p, and miR-424-5p could regulate cell cycle and further inhibit the proliferation of HCC cells by targeting E2F7.

| S-EPMC7671513 | biostudies-literature

miR-125b-5p inhibits cell proliferation, migration, and invasion in hepatocellular carcinoma via targeting <i>TXNRD1</i>.

Project description:BackgroundThioredoxin reductase 1 (TXNRD1) is an antioxidant enzyme reportedly overexpressed in hepatocellular carcinoma (HCC); however, the detailed function and mechanisms of TXNRD1 in HCC remain obscure. In this study, we investigated the miR-125b-5p-specific regulation of TXNRD1 levels and its effect on HCC cells.MethodsWe detected miR-125b-5p levels in human HCC tissue samples through quantitative reverse transcription polymerase chain reaction (qRT-PCR), and in vitro experiments were employed to investigate the effect of miR-125b-5p on HCC cell proliferation, migration, and invasion. Additionally, we examined miR-125b-5p-mediated changes in TXNRD1 levels by qRT-PCR and western blotting, and a dual luciferase-reporter assay was conducted to confirm direct targeting of the 3' untranslated region of TXNRD1 mRNA by miR-125b-5p.ResultsmiR-125b-5p expression was reduced in HCC tissues relative to that in matched para-carcinoma tissues; this finding was verified in HCC cohorts from the Gene Expression Omnibus and The Cancer Genome Atlas. Additionally, low miR-125b-5p expression was associated with poor prognosis in HCC patients, and gene-set enrichment analysis indicated that miR-125b-5p levels were associated with HCC proliferation and metastasis. As predicted, overexpressing miR-125b-5p restrained the proliferation, migration, and invasion of Huh7 and SK-Hep-1 cells and forced expression of the miR-125b-5p-downregulated TXNRD1 mRNA and protein levels in HCC cells. Moreover, dual luciferase-reporter assays revealed that miR-125b-5p targets TXNRD1 to directly regulate its expression, whereas TXNRD1 overexpression abolishes the inhibitory effect of miR-125b-5p on HCC cell proliferation, migration, and invasion.ConclusionsThese results demonstrated miR-125b-5p as a tumor suppressor in HCC through its inhibition of TXNRD1, thereby suggesting it as a potential target for the clinical treatment of HCC.

| S-EPMC6668076 | biostudies-literature

The Human Novel Gene LNC-HC Inhibits Hepatocellular Carcinoma Cell Proliferation by Sequestering hsa-miR-183-5p.

Project description:Hepatocellular carcinoma (HCC) is the most commonly diagnosed cancer and the leading cause of cancer mortality. Several lines of evidence have demonstrated the aberrant expression of long noncoding RNAs (lncRNAs) in carcinogenesis and their universal regulatory properties. A thorough understanding of lncRNA regulatory roles in HCC pathology would contribute to HCC prevention and treatment. In this study, we identified a novel human lncRNA, LNC-HC, with significantly reduced levels in hepatic tumors from patients with HCC. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyltetrazolium bromide) assays as well as colony formation and wound healing experiments showed that LNC-HC significantly inhibited the proliferation of the HCC cell line Huh7. Xenograft transplantation of LNC-HC-overexpressing Huh7 cells in nude mice resulted in the production of smaller tumors. Mechanistically, LNC-HC inhibited the proliferation of HCC cells by directly interacting with hsa-miR-183-5p. LNC-HC rescued the expression of five tumor suppressors, including AKAP12, DYRK2, FOXN3, FOXO1, and LATS2, that were verified as target genes of hsa-miR-183-5p. Overall, human LNC-HC was identified as a novel tumor suppressor that could inhibit HCC cell proliferation in vitro and suppress tumor growth in vivo by competitively binding hsa-miR-183-5p as a competing endogenous RNA (ceRNA). These findings suggest that LNC-HC could be a biomarker of HCC and provide a novel therapeutic target for HCC treatment.

| S-EPMC7150434 | biostudies-literature

HOXA-AS3 Promotes Proliferation and Migration of Hepatocellular Carcinoma Cells via the miR-455-5p/PD-L1 Axis.

Project description:Hepatocellular carcinoma (HCC) is the most prevalent type of hepatic carcinoma. Long noncoding RNAs (lncRNAs) are considered crucial regulators of gene expression; however, their functions in HCC are not well understood. Thus, the present study is aimed at elucidating the functions of the lncRNA HOXA-AS3 in HCC. The functions of the HOXA-AS3/miR-455-5p/programmed death-ligand 1 (PD-L1) axis were investigated in vitro via qRT-PCR and dual-luciferase reporter assays. The effect of HOXA-AS3 expression on tumor growth and metastasis was assessed using a mouse xenograft model. High HOXA-AS3 expression was observed in the HCC cell lines. Furthermore, overexpression of HOXA-AS3 in HCC cells enhanced proliferation, migration, and invasion, regulated the cell cycle, and retarded apoptosis. We also identified an miR-455-5p binding site in HOXA-AS3. By sponging miR-455-5p, HOXA-AS3 increased the expression of PD-L1. Additionally, both the inhibition of PD-L1 and overexpression of miR-455-5p reversed the effects on cell proliferation and invasion triggered by the overexpression of HOXA-AS3. In conclusion, HOXA-AS3 modulated the functions of HCC cells through the miR-455-5p/PD-L1 axis. Therefore, HOXA-AS3 may be a novel therapeutic target for HCC.

| S-EPMC8723882 | biostudies-literature

LINC02362/hsa-miR-18a-5p/FDX1 axis suppresses proliferation and drives cuproptosis and oxaliplatin sensitivity of hepatocellular carcinoma.

Project description:Cuproptosis is a novel cell death mechanism caused by copper overload, with FDX1 serving as the key regulator. LncRNAs are known to play a significant role in the aberrant regulation of gene expression in hepatocellular carcinoma (HCC). In this study, we investigated the biological role of the LINC02362/hsa-miR-18a-5p/FDX1 axis in HCC. We first explored the expression pattern, prognostic value, biological functions, drug sensitivity, and immune effect of FDX1. Using bioinformatics techniques, we then predicted several potential target lncRNAs and miRNAs. We identified a lncRNA-miRNA-FDX1 axis based on the ceRNA mechanism. In vitro experiments were conducted to validate the relationship between the lncRNA-miRNA-FDX1 axis and its biological effects in HCC. Finally, we investigated the relationship between the LINC02362/hsa-miR-18a-5p/FDX1 axis and oxaliplatin-induced cuproptosis in HCC. Our findings indicated that FDX1 expression was downregulated in HCC tissues; however, elevated FDX1 expression correlates with improved prognosis and heightened sensitivity to oxaliplatin. We confirmed that LINC02362 binds to and directly regulates the expression of miR-18a-5p, with FDX1 a target of miR-18a-5p. Experimental results suggested that upregulating LINC02362/hsa-miR-18a-5p/FDX1 axis suppressed the proliferation of HCC cells. Furthermore, LINC02362 knockdown led to a reduction in copper concentration and resistance to elesclomol-Cu. We also discovered that augmenting the LINC02362/hsa-miR-18a-5p/FDX1 axis could bolster the sensitivity of HCC to oxaliplatin through cuproptosis. This work presents the LINC02362/hsa-miR-18a-5p/FDX1 axis as a novel pathway that triggers cuproptosis and enhances the sensitivity of HCC to oxaliplatin, presenting a promising therapeutic avenue to combat oxaliplatin resistance in HCC.

| S-EPMC10695789 | biostudies-literature

[Corrigendum] lncRNA DQ786243 promotes hepatocellular carcinoma cell invasion and proliferation by regulating the miR‑15b‑5p/Wnt3A axis.

Project description:Following the publication of this article, an interested reader drew to the authors' attention that the primer sequences written for lncRNA DQ786243 and miR‑15b‑5p on p. 2 in the study were incorrect. Upon requesting an explanation of these errors from the authors, they realized that, regarding the sequence of the reverse primer for lncRNA DQ786243, three nucleotides were omitted from its 3'‑end [the sequence of this primer on p. 2, right‑hand column, line 25 should have been written as 5'‑CTTCTGCTGGGCTGTTGAGTG‑3' (with the omitted nucleotides highlighted in bold)]. Regarding the primers of miR‑15b‑5p, the authors used the mature miR‑15b‑5p sequence as the forward primer; however, they inadvertently overlooked replacing U with T in the description of the forward primer of miR‑15b‑5p, and therefore the sequence of the forward primer of miR‑15b‑5p on line 27 should have been written as 5'‑TAGCAGCACATCATGGTTTACA‑3'. Moreover, a universal reverse primer was used for the reverse primer of miR‑15b‑5p, as provided by the kit [specifically, the authors used an Mir‑X miRNA qRT‑PCR TB Green Kit (Takara Bio USA, Inc.) for detecting the expression of miR‑15b‑5p, and the reverse primer was supplied in the kit]; however, a different primer sequence used in the authors' lab was erroneously written as the reverse primer of miR‑15b‑5p in the manuscript. Finally, note that the title was published with a typographical error: "miR‑15p‑5p" in the title should have been written as "miR‑15b‑5p", as appeared elsewhere throughout the paper, and the corrected title is presented above. The authors are grateful to the Editor of Molecular Medicine Reports for allowing them the opportunity to publish this corrigendum, and all the authors agree with its publication. The authors also regret the inconvenience that these mistakes have caused. [Molecular Medicine Reports 23: 318, 2021; DOI: 10.3892/mmr.2021.11957].

| S-EPMC9813549 | biostudies-literature

miR-564 inhibits hepatocellular carcinoma cell proliferation and invasion by targeting the GRB2-ERK1/2-AKT axis.

Project description:Recent studies have shown that miR-564 is closely related to the development of various tumors, including breast cancer, lung cancer and glioma. However, few studies have examined miR-564 in hepatocellular carcinoma (HCC). Here, we demonstrated that miR-564 expression in HCC tissues was lower than that in adjacent noncancerous tissues and that miR-564 expression was associated with tumor size, tumor number and vein invasion. Bioinformatics analyses showed that low levels of miR-564 were correlated with poor prognosis. Furthermore, upregulation of miR-564 impaired SMCC7721 and MHCC97H cell proliferation, migration and invasion in vitro and reduced tumorigenesis in vivo. Next, we found that GRB2 was a direct target gene of miR-564 in the HCC cell lines. GRB2 was highly expressed in HCC tissues and negatively correlated with miR-564 expression levels. When GRB2 was downregulated by GRB2-siRNA, HCC cell proliferation, invasion and metastasis were impaired, and restoring GRB2 expression partially reversed the inhibitory effects of miR-564. Western blot analysis showed that miR-564 overexpression reduced GRB2 expression in HCC cell lines and inhibited ERK1/2 and AKT phosphorylation. miR-564 overexpression also upregulated the epithelial-like cell marker E-cadherin and downregulated the interstitial cell-like markers N-cadherin and vimentin. These results suggest that miR-564 inhibits the malignant phenotype of HCC cells by targeting the GRB2-ERK1/2-AKT axis. Consequently, miR-564 may be used as a prognostic marker and therapeutic target for HCC.

| S-EPMC5746087 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data