Browse
Submit Data
Databases
API
Help

Dataset Information

18 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SARS-CoV-2 and dengue virus coinfection in an adult with beta-thalassemia (trait): A case report from Bangladesh with literature review

ABSTRACT:

Introduction

Coinfections are common in pandemics, however not in recorded patients with hemoglobinopathies. The Coronavirus Disease 2019 (COVID-19) pandemic struck Bangladesh at the beginning of March 2020, which is also an apt period for endemic Dengue fever in this monsoon region.

Case report

We report a 30-year-old man with hemoglobinopathies coinfected with Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) and Dengue virus. Dengue virus was detected by Enzyme-linked Immunosorbent Assay (ELISA). COVID-19 was confirmed by Reverse-transcription Polymerase Chain Reaction (RT-PCR) and Hemoglobin Electrophoresis revealed heterozygous beta-thalassemia or thalassemia trait. The patient was treated successfully at Dhaka Hospital in icddr,b during COVID-19 emergency response with symptomatic supportive treatment for COVID-19 and appropriate fluid therapy for dengue fever in response to daily hematocrit level. The patient's repeated RT-PCR for COVID-19 on day-21 became negative. For thalassemia, the patient was advised to have genetic counseling and family screening on discharge.

Conclusion

The possibility of coinfection between COVID-19 and Dengue fever may be considered in a COVID-19 patient with unremitting fever especially in an area where Dengue fever is epidemic that may further help to attain appropriate management of the patient. COVID-19; SARS-CoV-2; Dengue; Beta-thalassemia; Hemoglobinopathies; Bangladesh.

SUBMITTER: Hossain M

PROVIDER: S-EPMC8526441 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

The need to perform α-thalassemia genetic testing in Italian patients with β-thalassemia trait: A case report.

Project description:Here, we describe a case report of a Sardinian woman diagnosed as pure beta-thalassemia carrier for her anemia who underwent to alpha-thalassemia genetic testing that revealed she was heterozygous for both thalssemias. This allowed to reach a conclusive diagnosis useful for family counseling and for assess the reproductive risk.

| S-EPMC9483816 | biostudies-literature

Impaired acylcarnitine profile in transfusion-dependent beta-thalassemia major patients in Bangladesh.

Project description:Patients with beta-thalassemia major (BTM) suffer from fatigue, poor physical fitness, muscle weakness, lethargy, and cardiac complications which are related to an energy crisis. Carnitine and acylcarnitine derivatives play important roles in fatty acid oxidation, and deregulation of carnitine and acylcarnitine metabolism may lead to an energy crisis. The present study aimed to investigate carnitine and acylcarnitine metabolites to gain an insight into the pathophysiology of BTM. Dried blood spots of 45 patients with BTM and 96 age-matched healthy controls were analyzed for free carnitine and 24 acylcarnitines by using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Although medium chain acylcarnitine levels were similar in the patients with BTM and healthy controls, free carnitine, short chain acylcarnitines, long chain acylcarnitines, and total acylcarnitine levels were significantly lower in patients with BTM than in the healthy controls (P < 0.05). Moreover, an impaired fatty acid oxidation rate was observed in the patients with BTM, as manifested by decreased fatty acid oxidation indicator ratios, namely C2/C0 and (C2 + C3)/C0. Furthermore, an increase in the C0/(C16 + C18) ratio indicated reduced carnitine palmitoyltransferase-1 (CPT-1) activity in the patients with BTM compared with that in the healthy controls. Thus, a low level of free carnitine and acylcarnitines together with impaired CPT-1 activity contribute to energy crisis-related complications in the patients with BTM.

| S-EPMC6057484 | biostudies-literature

Differentiation of beta thalassemia trait from iron deficiency anemia by hematological indices.

Project description:We aimed at finding out reliable parameter in the differentiation of iron deficiency anemia (IDA) and beta-thalassemia trait (β-TT) in the adult population subjected to Saudi Arabian Premarital Screening Program.A total of 620 adults (age range 21-36 years) reported during February 2012 to November 2012. Tests for serum iron and ferritin were carried out in individuals showing low hemoglobin (Hb). All the selected subjects' samples were subjected to blood morphology, comparison of MCV, RBC count. Red Cell Distribution Width (RDW) was noted from the Coulter Report whereas Red Cell Distribution Width Index (RDWI) value was calculated for all the samples.A total of one hundred &thirty-five individuals with hypochromic microcytic anemia having normal hemoglobin F and hemoglobin A2 < 3.2% were inducted in the study. Ninety-three were diagnosed having IDA, whereas thirty-two were having βTT. Ten individuals revealed other causes of anemia. The RBC count was higher, and MCV was much lower in βTT as compared to IDA. Both groups were subjected to RDW and RDWI, however, RDWI which showed better sensitivity and specificity for βTT.RDWI is a reliable and useful index for differentiation among IDA and βTT, as compared to RDW.

| S-EPMC5510123 | biostudies-other

Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.

Project description:β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

| S-EPMC10704694 | biostudies-literature

Case Report: β-thalassemia major on the East African coast.

Project description:Background: β-thalassemia is rare in sub-Saharan Africa and to our knowledge there has been no case of homozygous β-thalassemia major reported from this region. In a recent cohort study, we identified four β-thalassemia mutations among 83 heterozygous carriers in Kilifi, Kenya. One of the mutations identified was a rare β-globin gene initiation codon mutation (ATG➝ACG) (rs33941849). Here we present a patient with β-thalassemia major resulting from this mutation, only the second homozygous patient to have been reported. Methods: The female patient presented to Kilifi County Hospital aged two years with a one week left sided abdominal swelling. Clinical, hematological and genetic information were collected at admission and follow-up. Results: Admission bloods revealed marked anemia, with a hemoglobin (Hb) value of 6.6 g/dL and a low mean corpuscular volume of 64 fL. High performance liquid chromatography (HPLC) revealed the absence of HbA0 and elevated levels of HbF, suggesting a diagnosis of β-thalassemia major. Sequencing revealed that the child was homozygous for the rs33941849 initiation codon mutation. Conclusions: We hope that this study will create awareness regarding the presence of β-thalassemia as a potential public health problem in the East Africa region and will prompt the development of local guidelines regarding the diagnosis and management of this condition.

| S-EPMC10551670 | biostudies-literature

Coincidence of Niemann-Pick Disease and beta-Thalassemia; a Case Report.

Project description:BACKGROUND:Niemann-Pick disease and ?-thalassemia are distinct conditions with specific clinical and morphological manifestations. ?-thalassemia is the most common inherited blood disorder in Iran whereas Niemann-Pick disease, a lysosomal storage disorder, is rarely found in this country. CASE PRESENTATION:This 5-month old girl, a known case of ?-thalassemia major was hospitalized for failure to thrive and hepathosplenomegaly. Because of unusual splenomegaly and liver enzymes disturbance that was not compatible with the first diagnosis, further evaluation revealed cherry red spot and high lipid profile suggestive of lysosomal storage disease. Foamy cells in the bone marrow and low activity of the specific enzyme led to the diagnosis of Niemann-Pick disease. CONCLUSION:This unique case illustrates the importance of looking for a second pathological condition in a patient whose clinical profile does not support the first diagnosis in its entirety.

| S-EPMC3446085 | biostudies-literature

Asymptomatic intracranial aneurysms in beta-thalassemia: a three-year follow-up report.

Project description:BACKGROUND:No information is currently available regarding the natural history of asymptomatic intracranial aneurysms in beta-thalassemia, raising several concerns about their proper management. METHODS:We performed a prospective longitudinal three-year-long MR-angiography study on nine beta-thalassemia patients (mean-age 40.3 ± 7.5, six females, 8 transfusion dependent) harboring ten asymptomatic intracranial aneurysms. In addition, we analyzed the clinical files of all adult beta-thalassemia patients (160 patients including those followed with MR-angiography, 121 transfusion dependent) referring to our Centers between 2014 and 2019 searching for history of subarachnoid hemorrhage or history of symptomatic intracranial aneurysms. RESULTS:At the end of the three-year-long follow-up, no patient showed any change in the size and shape of the aneurysms, none presented new intracranial aneurysms or artery stenoses, none showed new brain vascular-like parenchymal lesions or enlargement of the preexisting ones. Besides, in our database of all adult beta-thalassemia patients, no one had history of subarachnoid hemorrhage or history of symptomatic intracranial aneurysms. CONCLUSIONS:Incidental asymptomatic intracranial aneurysms do not seem to be associated, in beta-thalassemia, with an increased risk of complications (enlargement or rupture) at least in the short term period, helping to optimize human and economic resources and patient compliance during their complex long-lasting management.

| S-EPMC6971974 | biostudies-literature

SARS-CoV-2 infection in patients with β-thalassemia: Experience from Lebanon.

Project description: Not available

| S-EPMC8212121 | biostudies-literature

Erythrocyte Catalase Activity in More Frequent Microcytic Hypochromic Anemia: Beta-Thalassemia Trait and Iron Deficiency Anemia.

Project description:Most common microcytic hypochromic anemias are iron deficiency anemia (IDA) and ?-thalassemia trait (BTT), in which oxidative stress (OxS) has an essential role. Catalase causes detoxification of H2O2 in cells, and it is an indispensable antioxidant enzyme. The study was designed to measure erythrocyte catalase activity (ECAT) in patients with IDA (10) or BTT (21), to relate it with thalassemia mutation type (? (0) or ? (+)) and to compare it with normal subjects (67). Ninety-eight individuals were analyzed since September 2013 to June 2014 in Tucumán, Argentina. Total blood count, hemoglobin electrophoresis at alkaline pH, HbA2, catalase, and iron status were performed. ?-thalassemic mutations were determined by real-time PCR. Normal range for ECAT was 70,0-130,0?MU/L. ECAT was increased in 14% (3/21) of BTT subjects and decreased in 40% (4/10) of those with IDA. No significant difference (p = 0,245) was shown between normal and BTT groups, while between IDA and normal groups the difference was proved to be significant (p = 0,000). In ? (0) and ? (+) groups, no significant difference (p = 0,359) was observed. An altered ECAT was detected in IDA and BTT. These results will help to clarify how the catalase activity works in these anemia types.

| S-EPMC4615862 | biostudies-literature

Short Report: Adult Aedes abundance and risk of dengue transmission.

Project description:Dengue is transmitted mainly by the adult female Aedes aegypti mosquito. However, little is known about the impact of adult Aedes abundance on the risk of dengue transmission. Here we analysed nationally representative dengue case and vector surveillance data collected from Singapore, to determine the effect of adult Aedes abundance on the risk of dengue transmission. A case was an area with active dengue transmission as indicated by the presence of dengue cluster. A control was an area where no dengue cluster was reported. Using multivariate logistic regression, we analysed 88 cases and 602 controls and estimated the odds of dengue cluster formation at various adult Aedes abundance levels, estimated by the mean number of adult female Aedes per Gravitrap per week and categorised into Low, Moderate, High and Very High abundance level. We found that the risk of dengue cluster formation was positively associated with adult Ae. aegypti abundance. We observed a three to four-fold increase in the odds of dengue clusters forming in areas with High (AOR: 3.40, 95% CI: 2.09, 5.52) and Very High (AOR: 3.99, 95% CI: 2.46, 6.46) adult Aedes aegypti abundance level compared to those with low Ae. aegypti abundance level. Our study strengthens the evidence for the use of adult Aedes indices for dengue risk assessment and early warning for dengue outbreaks. Entomological indicators of adult Ae. aegypti could be used to anticipate and prioritize areas for dengue control.

| S-EPMC8205144 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data