CpG Oligodeoxynucleotides for Anticancer Monotherapy from Preclinical Stages to Clinical Trials.
Ontology highlight
ABSTRACT:
SUBMITTER: Zhang Z
PROVIDER: S-EPMC8780291 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Numerous monoclonal antibodies (mAb) targeting tumor antigens have recently been developed. Antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP) via effector cells such as tumor-infiltrating natural killer (NK) cells and macrophages are often involved in mediating the antitumor activity of mAb. CpG oligodeoxynucleotides (ODN) have a potent antitumor activity and are considered to increase tumor infiltration of NK cells and macrophages. Our group previously reported significant antitumor activity of anti-bone marrow stromal antigen 2 (BST2) mAb against BST2-positive endometrial cancer cells through ADCC. In this study, we evaluated the synergistic antitumor activity of combination therapy with anti-BST-2 mAb and CpG ODN using SCID mice and elucidated the mechanisms underlying this activity. Anti-BST2 mAb and CpG ODN monotherapy had a significant dose-dependent antitumor activity (P = 0.0135 and P = 0.0196, respectively). Combination therapy with anti-BST2 mAb and CpG ODN had a significant antitumor activity in SCID mice (P < 0.01), but not in NOG mice. FACS analysis revealed significantly increased numbers of NK cells and macrophages in tumors treated with a combination of anti-BST2 mAb and CpG ODN and with CpG ODN alone in SCID mice (P < 0.05 and P < 0.01, respectively). These results suggested that the combination therapy with anti-BST2 mAb and CpG ODN has a significant antitumor activity and induces tumor infiltration of NK cells and macrophages. Combination therapy with CpG ODN and anti-BST2 mAb or other antitumor mAb depending on ADCC may represent a new treatment option for cancer.
| S-EPMC4638016 | biostudies-literature
Project description:Unmethylated cytosine-phosphate-guanosine (CpG) oligodeoxynucleotides (ODNs) are recognized by Toll-like receptor 9 (TLR9) found in antigen-presenting cells and B cells and can activate the immune system. Using CpG ODNs as an adjuvant has been found to be effective for treating infectious diseases, cancers, and allergies. Because natural ODNs with only a phosphodiester backbone are easily degraded by nuclease (deoxyribonuclease [DNase]) in serum, CpG ODNs with a phosphorothioate backbone have been studied for clinical application. CpG ODNs with a phosphorothioate backbone have raised concern regarding undesirable side effects; however, several CpG ODNs with only a phosphodiester backbone have been reported to be stable in serum and to show an immunostimulatory effect. In recent years, research has been conducted on delivery systems for CpG ODNs using nanoparticles (NPs). The advantages of NP-based delivery of CpG ODN include (1) it can protect CpG ODN from DNase, (2) it can retain CpG ODN inside the body for a long period of time, (3) it can improve the cellular uptake efficiency of CpG ODN, and (4) it can deliver CpG ODN to the target tissues. Because the target cells of CpG ODN are cells of the immune system and TLR9, the receptor of CpG ODN is localized in endolysosomes, CpG ODN delivery systems are required to have qualities different from other nucleic acid drugs such as antisense DNA and small interfering RNA. Studies until now have reported various NPs as carriers for CpG ODN delivery. This review presents DNase-resistant CpG ODNs with various structures and their immunostimulatory effects and also focuses on delivery systems of CpG ODNs that utilize NPs. Because CpG ODNs interact with TLR9 and activate both the innate and the adaptive immune system, the application of CpG ODNs for the treatment of cancers, infectious diseases, and allergies holds great promise.
| S-EPMC3356174 | biostudies-literature
Project description:Circulating mitochondrial DNA (mtDNA) is receiving increasing attention as a danger-associated molecular pattern in conditions such as autoimmunity, cancer, and trauma. We report here that human lymphocytes [B cells, T cells, natural killer (NK) cells], monocytes, and neutrophils derived from healthy blood donors, as well as B cells from chronic lymphocytic leukemia patients, rapidly eject mtDNA as web filament structures upon recognition of CpG and non-CpG oligodeoxynucleotides of class C. The release was quenched by ZnCl2, independent of cell death (apoptosis, necrosis, necroptosis, autophagy), and continued in the presence of TLR9 signaling inhibitors. B-cell mtDNA webs were distinct from neutrophil extracellular traps concerning structure, reactive oxygen species (ROS) dependence, and were devoid of antibacterial proteins. mtDNA webs acted as rapid (within minutes) messengers, priming antiviral type I IFN production. In summary, our findings point at a previously unrecognized role for lymphocytes in antimicrobial defense, utilizing mtDNA webs as signals in synergy with cytokines and natural antibodies, and cast light on the interplay between mitochondria and the immune system.
| S-EPMC5776968 | biostudies-literature
Project description:Recommendations for the diagnosis of preclinical Alzheimer disease (AD) have been formulated by a workgroup of the National Institute on Aging and Alzheimer's Association. Three stages of preclinical AD were described. Stage 1 is characterized by abnormal levels of ?-amyloid. Stage 2 represents abnormal levels of ?-amyloid and evidence of brain neurodegeneration. Stage 3 includes the features of stage 2 plus subtle cognitive changes. Stage 0, not explicitly defined in the criteria, represents subjects with normal biomarkers and normal cognition. The ability of the recommended criteria to predict progression to cognitive impairment is the crux of their validity.Using previously developed operational definitions of the 3 stages of preclinical AD, we examined the outcomes of subjects from the Mayo Clinic Study of Aging diagnosed as cognitively normal who underwent brain MRI or [(18)F]fluorodeoxyglucose and Pittsburgh compound B PET, had global cognitive test scores, and were followed for at least 1 year.Of the 296 initially normal subjects, 31 (10%) progressed to a diagnosis of mild cognitive impairment (MCI) or dementia (27 amnestic MCI, 2 nonamnestic MCI, and 2 non-AD dementias) within 1 year. The proportion of subjects who progressed to MCI or dementia increased with advancing stage (stage 0, 5%; stage 1, 11%; stage 2, 21%; stage 3, 43%; test for trend, p < 0.001).Despite the short follow-up period, our operationalization of the new preclinical AD recommendations confirmed that advancing preclinical stage led to higher proportions of subjects who progressed to MCI or dementia.
| S-EPMC3348848 | biostudies-other
Project description:Mesothelin is a tumor differentiation antigen that is highly expressed in several malignant diseases in humans, including malignant mesothelioma and pancreatic, ovarian, and lung adenocarcinomas. The limited expression of mesothelin on normal human tissues and its high expression in many common cancers make it an attractive candidate for cancer therapy. Several agents, including an immunotoxin, monoclonal antibody, antibody drug conjugate, and tumor vaccine, are in various stages of development to treat patients with mesothelin-expressing tumors. This review highlights ongoing clinical trials, as well as other approaches to exploit mesothelin for cancer therapy, that are in preclinical development.
| S-EPMC3297681 | biostudies-other
Project description:Nucleic acid oligodeoxynucleotides (ODN) are increasingly used in biological research and in clinics where they are used for both diagnostic and therapeutic purposes. In order to increase the stability and efficacy of ODNs, various chemical modifications have been applied to create nucleic acid derivatives that are not recognized by endogenous nucleic acid cleavage mechanisms. One of the most common and cost-effective modifications is the phosphothioate (PTO) modification. The PTO modification is implemented mainly in antisense ODN, but also in ODN that were shown to activate members of the toll-like receptor (TLR) family such as TLR3 (poly-I:C), TLR8 (ssRNA) and TLR9 (CpG). We recently found that PTO-ODN aimed at activating TLR9 induce a non-TLR9-specific detachment phenotype in a growth-substrate dependent manner. Moreover, we found that unmodified and PTO-modified TLR ligands induce distinct patterns of gene expression in cultured neural cells. These findings suggest that PTO-ODN can cause nonspecific effects on cell adhesion that could compromise interpretation of data from experiments using PTO-ODN.
| S-EPMC2712808 | biostudies-other
Project description:Currently cancer is the second leading cause of death globally and worldwide incidence and mortality rates of all cancers of males and females are rising tremendously. In spite of advances in chemotherapy and radiation, metastasis and recurrence are considered as the major causes of cancer related deaths. Hence there is a mounting need to develop new therapeutic modalities to treat metastasis and recurrence in cancers. A significant amount of substantiation from epidemiological, clinical and laboratory research highlights the importance of diet and nutrition in cancer chemoprevention. Enterolactone (EL) is a bioactive phenolic metabolite known as a mammalian lignan derived from dietary lignans. Here in we review the reported anti-cancer properties of EL at preclinical as well as clinical level. Several in-vivo and in-vitro studies have provided strong evidence that EL exhibits potent anti-cancer and/or protective properties against different cancers including breast, prostate, colo-rectal, lung, ovarian, endometrial, cervical cancers and hepatocellular carcinoma. Reported laboratory studies indicate a clear role for EL in preventing cancer progression at various stages including cancer cell proliferation, survival, angiogenesis, inflammation and metastasis. In clinical settings, EL has been reported to reduce risk, decrease mortality rate and improve overall survival particularly in breast, prostate, colon, gastric and lung cancer. Further, the in-vitro human cell culture studies provide strong evidence of the anticancer and antimetastatic mechanisms of EL in several cancers. This comprehensive review supports an idea of projecting EL as a promising candidate for developing anticancer drug or adjunct dietary supplements and nutraceuticals.
| S-EPMC6938675 | biostudies-literature
Project description:Participant registries are repositories of individuals who have expressed willingness to learn about studies for which they may be eligible. Registries are increasingly being utilized to improve recruitment to preclinical Alzheimer's disease (AD) clinical trials, which require large screening efforts to identify adequate numbers of participants who meet enrollment criteria. Recruiting to preclinical AD trials from registries is made more efficient through registry collection of data that permits exclusion of those who will not be eligible and identifies individuals most likely to qualify for trials. Such data could include self-reported disease family history or other risk factors, but could also include cognitive, genetic, or biomarker testing outcomes. Few data are available to guide investigators overseeing registries and important ethical questions are likely to arise related to their conduct, especially in registries collecting AD risk information. This article outlines three areas of consideration for registry investigators: informed consent, disclosure, and sponsorship.
| S-EPMC5399544 | biostudies-literature