Dataset Information

Identification of a Potential mRNA-based Vaccine Candidate against the SARS-CoV-2 Spike Glycoprotein: A Reverse Vaccinology Approach.

ABSTRACT: The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.

SUBMITTER: Durojaye OA

PROVIDER: S-EPMC9111088 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Infectious bursal disease virus is the causative agent of infectious bursal disease (Gumboro disease), a highly contagious immunosuppressive disease of chicken with a substantial economic impact on small- and large-scale poultry industries worldwide. Currently, live attenuated vaccines are widely used to control the disease in chickens despite their issues with safety (immunosuppression and bursal atrophy) and efficiency (breaking through the maternally-derived antibody titer). To overcome the drawbacks, the current study has, for the first time, attempted to construct a computational model of a multiepitope based vaccine candidate against infectious bursal disease virus, which has the potential to overcome the safety and protection issues found in the existing live-attenuated vaccines. The current study used a reverse vaccinology based immunoinformatics approach to construct the vaccine candidate using major and minor capsid proteins of the virus, VP2 and VP3, respectively. The vaccine construct was composed of four CD8+ epitopes, seven CD4+ T-cell epitopes, 11 B-cell epitopes and a Cholera Toxin B adjuvant, connected using appropriate flexible peptide linkers. The vaccine construct was evaluated as antigenic with VaxiJen Score of 0.6781, immunogenic with IEDB score of 2.89887 and non-allergenic. The 55.64 kDa construct was further evaluated for its physicochemical characteristics, which revealed that it was stable with an instability index of 16.24, basic with theoretical pI of 9.24, thermostable with aliphatic index of 86.72 and hydrophilic with GRAVY score of -0.256. The docking and molecular dynamics simulation studies of the vaccine construct with Toll-like receptor-3 revealed fair structural interaction (binding affinity of -295.94 kcal/mol) and complex stability. Further, the predicted induction of antibodies and cytokines by the vaccine construct indicated the possible elicitation of the host's immune response against the virus. The work is a significant attempt to develop next-generation vaccines against the infectious bursal disease virus though further experimental studies are required to assess the efficacy and protectivity of the proposed vaccine candidate in vivo.

Dataset Information

Identification of a Potential mRNA-based Vaccine Candidate against the SARS-CoV-2 Spike Glycoprotein: A Reverse Vaccinology Approach.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets