Browse
Submit Data
Databases
API
Help

Dataset Information

16 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The GmSNAP11 Contributes to Resistance to Soybean Cyst Nematode Race 4 in Glycine max.

ABSTRACT: Soybean cyst nematode (SCN) has devastating effects on soybean production, making it crucial to identify genes conferring SCN resistance. Here we employed next-generation sequencing-based bulked segregant analysis (BSA) to discover genomic regions, candidate genes, and diagnostic markers for resistance to SCN race 4 (SCN4) in soybean. Phenotypic analysis revealed highly significant differences among the reactions of 145 recombinant inbred lines (RILs) to SCN4. In combination with euclidean distance (ED) and Δsingle-nucleotide polymorphism (SNP)-index analyses, we identified a genomic region on Gm11 (designated as rhg1-paralog) associated with SCN4 resistance. Overexpression and RNA interference analyzes of the two candidate genes identified in this region (GmPLAC8 and GmSNAP11) revealed that only GmSNAP11 significantly contributes to SCN4 resistance. We developed a diagnostic marker for GmSNAP11. Using this marker, together with previously developed markers for SCN-resistant loci, rhg1 and Rhg4, we evaluated the relationship between genotypes and SCN4 resistance in 145 RILs and 30 soybean accessions. The results showed that all the SCN4-resistant lines harbored all the three loci, however, some lines harboring the three loci were still susceptible to SCN4. This suggests that these three loci are necessary for the resistance to SCN4, but they alone cannot confer full resistance. The GmSNAP11 and the diagnostic markers developed could be used in genomic-assisted breeding to develop soybean varieties with increased resistance to SCN4.

SUBMITTER: Shaibu AS

PROVIDER: S-EPMC9289622 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Identification of resistant sources from <i>Glycine max</i> against soybean cyst nematode.

Project description:Soybean cyst nematode (SCN, Heterodera glycines, HG) is one of the severe pests in plant-parasitic nematodes, which impairs root development and causes severe losses in soybean production worldwide. Breeding SCN-resistant cultivars is an important measure for securing harvests without affecting the environment, as can be done with pesticides. The majority of genetic resources for plant pest resistances are found in wild or closely related species which are often difficult to use in breeding due to crossing barriers or close linkage with unfavorable agronomic traits. In this study, 12 soybean cultivars were evaluated for their marker haplotype at the rhg1 and Rhg4 SCN resistance loci and their SCN resistance tested against multiple races in environmentally controlled bioassays. The results showed that all 12 cultivars displayed Peking-type resistance marker haplotypes and all of them proved to be resistant to multiple SCN races. These cultivars provide potential for improving H. glycines resistance of soybean as donor parent in breeding and can contribute to reduce SCN field populations as part of a sustainable agriculture management.

| S-EPMC10028208 | biostudies-literature

Exocyst components promote an incompatible interaction between Glycine max (soybean) and Heterodera glycines (the soybean cyst nematode).

Project description:Vesicle and target membrane fusion involves tethering, docking and fusion. The GTPase SECRETORY4 (SEC4) positions the exocyst complex during vesicle membrane tethering, facilitating docking and fusion. Glycine max (soybean) Sec4 functions in the root during its defense against the parasitic nematode Heterodera glycines as it attempts to develop a multinucleate nurse cell (syncytium) serving to nourish the nematode over its 30-day life cycle. Results indicate that other tethering proteins are also important for defense. The G. max exocyst is encoded by 61 genes: 5 EXOC1 (Sec3), 2 EXOC2 (Sec5), 5 EXOC3 (Sec6), 2 EXOC4 (Sec8), 2 EXOC5 (Sec10) 6 EXOC6 (Sec15), 31 EXOC7 (Exo70) and 8 EXOC8 (Exo84) genes. At least one member of each gene family is expressed within the syncytium during the defense response. Syncytium-expressed exocyst genes function in defense while some are under transcriptional regulation by mitogen-activated protein kinases (MAPKs). The exocyst component EXOC7-H4-1 is not expressed within the syncytium but functions in defense and is under MAPK regulation. The tethering stage of vesicle transport has been demonstrated to play an important role in defense in the G. max-H. glycines pathosystem, with some of the spatially and temporally regulated exocyst components under transcriptional control by MAPKs.

| S-EPMC7490361 | biostudies-literature

A virus-induced gene silencing method to study soybean cyst nematode parasitism in Glycine max.

Project description:BackgroundBean pod mottle virus (BPMV) based virus-induced gene silencing (VIGS) vectors have been developed and used in soybean for the functional analysis of genes involved in disease resistance to foliar pathogens. However, BPMV-VIGS protocols for studying genes involved in disease resistance or symbiotic associations with root microbes have not been developed.FindingsHere we describe a BPMV-VIGS protocol suitable for reverse genetic studies in soybean roots. We use this method for analyzing soybean genes involved in resistance to soybean cyst nematode (SCN). A detailed SCN screening pipeline is described.ConclusionsThe VIGS method described here provides a new tool to identify genes involved in soybean-nematode interactions. This method could be adapted to study genes associated with any root pathogenic or symbiotic associations.

| S-EPMC3708766 | biostudies-literature

Comparative RNA-Seq Analysis Uncovers a Complex Regulatory Network for Soybean Cyst Nematode Resistance in Wild Soybean (Glycine soja).

Project description:Soybean cyst nematode (SCN) is the most damaging pest of soybean worldwide. The molecular mechanism of SCN resistance remains largely unknown. We conducted a global RNA-seq comparison between a resistant genotype (S54) and a susceptible genotype (S67) of Glycine soja, the wild progenitor of soybean, to understand its regulatory network in SCN defense. The number of differentially expressed genes (DEGs) in S54 (2,290) was much larger than that in S67 (555). A number of defense-related genes/pathways were significantly induced only in S54, while photosynthesis and several metabolic pathways were affected in both genotypes with SCN infection. These defense-associated DEGs were involved in pathogen recognition, calcium/calmodulin-mediated defense signaling, jasmonic acid (JA)/ethylene (ET) and sialic acid (SA)-involved signaling, the MAPK signaling cascade, and WRKY-involved transcriptional regulation. Our results revealed a comprehensive regulatory network involved in SCN resistance and provided insights into the complex molecular mechanisms of SCN resistance in wild soybean.

| S-EPMC5575055 | biostudies-literature

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (<i>Glycine max</i>).

Project description:We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

| S-EPMC9501883 | biostudies-literature

Genetic architecture of wild soybean (Glycine soja) response to soybean cyst nematode (Heterodera glycines).

Project description:The soybean cyst nematode (SCN) is one of the most destructive pathogens of soybean plants worldwide. Host-plant resistance is an environmentally friendly method to mitigate SCN damage. To date, the resistant soybean cultivars harbor limited genetic variation, and some are losing resistance. Thus, a better understanding of the genetic mechanisms of the SCN resistance, as well as developing diverse resistant soybean cultivars, is urgently needed. In this study, a genome-wide association study (GWAS) was conducted using 1032 wild soybean (Glycine soja) accessions with over 42,000 single-nucleotide polymorphisms (SNPs) to understand the genetic architecture of G. soja resistance to SCN race 1. Ten SNPs were significantly associated with the response to race 1. Three SNPs on chromosome 18 were localized within the previously identified quantitative trait loci (QTLs), and two of which were localized within a strong linkage disequilibrium block encompassing a nucleotide-binding (NB)-ARC disease resistance gene (Glyma.18G102600). Genes encoding methyltransferases, the calcium-dependent signaling protein, the leucine-rich repeat kinase family protein, and the NB-ARC disease resistance protein, were identified as promising candidate genes. The identified SNPs and candidate genes can not only shed light on the molecular mechanisms underlying SCN resistance, but also can facilitate soybean improvement employing wild genetic resources.

| S-EPMC5680095 | biostudies-literature

Genome-Wide Association Study of Resistance to Soybean Cyst Nematode (Heterodera glycines) HG Type 2.5.7 in Wild Soybean (Glycine soja).

Project description:Soybean cyst nematode (SCN) is the most destructive soybean pest worldwide. Host plant resistance is the most environmentally friendly and cost-effective way of mitigating SCN damage to soybeans. However, overuse of the resistant soybean [Glycine max (L.) Merr.] cultivars from limited genetic resources has resulted in SCN race shifts in many soybean-growing areas. Thus, exploration of novel sources of SCN resistance and dissection of the genetic basis are urgently needed. In this study, we screened 235 wild soybean (Glycine soja Sieb. & Zucc.) accessions to identify genotypes resistant to SCN HG Type 2.5.7 (race 5), a less investigated type but is prevalent in the southeastern US. We also dissected the genetic basis of SCN resistance using a genome-wide association study with SNPs genotyped by SoySNP50k iSelect BeadChip. In total, 43 resistant accessions (female index < 30) were identified, with 10 SNPs being significantly associated with SCN HG 2.5.7 resistance in this wild species. Furthermore, four significant SNPs were localized to linked regions of the known quantitative trait locus (QTL) rhg1 on chromosome 18. The other four SNPs on chromosome 18 and two SNPs on chromosome 19 are novel. Genes encoding disease resistance-related proteins with a leucine-rich region, a mitogen-activated protein kinase (MAPK) on chromosome 18, and a MYB transcription factor on chromosome 19 were identified as promising candidate genes. The identified SNPs and candidate genes will benefit future marker-assisted breeding and dissection of the molecular mechanisms underlying the soybean-SCN interaction.

| S-EPMC4987380 | biostudies-literature

Novel resistance strategies to soybean cyst nematode (SCN) in wild soybean.

Project description:Soybean cyst nematode (SCN, Heterodera glycine Ichinohe) is the most damaging soybean pest worldwide and management of SCN remains challenging. The current SCN resistant soybean cultivars, mainly developed from the cultivated soybean gene pool, are losing resistance due to SCN race shifts. The domestication process and modern breeding practices of soybean cultivars often involve strong selection for desired agronomic traits, and thus, decreased genetic variation in modern cultivars, which consequently resulted in limited sources of SCN resistance. Wild soybean (Glycine soja) is the wild ancestor of cultivated soybean (Glycine max) and it's gene pool is indisputably more diverse than G. max. Our aim is to identify novel resistant genetic resources from wild soybean for the development of new SCN resistant cultivars. In this study, resistance response to HG type 2.5.7 (race 5) of SCN was investigated in a newly identified SCN resistant ecotype, NRS100. To understand the resistance mechanism in this ecotype, we compared RNA seq-based transcriptomes of NRS100 with two SCN-susceptible accessions of G. soja and G. max, as well as an extensively studied SCN resistant cultivar, Peking, under both control and nematode J2-treated conditions. The proposed mechanisms of resistance in NRS100 includes the suppression of the jasmonic acid (JA) signaling pathway in order to allow for salicylic acid (SA) signaling-activated resistance response and polyamine synthesis to promote structural integrity of root cell walls. Our study identifies a set of novel candidate genes and associated pathways involved in SCN resistance and the finding provides insight into the mechanism of SCN resistance in wild soybean, advancing the understanding of resistance and the use of wild soybean-sourced resistance for soybean improvement.

| S-EPMC8041904 | biostudies-literature

Genetics and Adaptation of Soybean Cyst Nematode to Broad Spectrum Soybean Resistance.

Project description:The soybean cyst nematode (SCN) Heterodera glycines is a major threat to soybean production, made more challenging by the current limitations of natural resistance for managing this pathogen. The use of resistant host cultivars is effective, but, over time, results in the generation of virulent nematode populations able to robustly parasitize the resistant host. In order to understand how virulence develops in SCN, we utilized a single backcross BC1F2 strategy to mate a highly virulent inbred population (TN20), capable of reproducing on all current sources of resistance, with an avirulent one (PA3), unable to reproduce on any of the resistant soybean lines. The offspring were then investigated to determine how virulence is inherited on the main sources of SCN resistance, derived from soybean lines Peking, PI 88788, PI 90763, and the broad spectrum resistance source PI 437654. Significantly, our results suggest virulence on PI 437654 is a multigenic recessive trait that allows the nematode to reproduce on all current sources of resistance. In addition, we examined how virulence on different sources of resistance interact by placing virulent SCN populations under secondary selection, and identified a strong counter-selection between virulence on PI 88788- and PI 90763-derived resistances, while no such counter-selection existed between virulence on Peking and PI 88788 resistance sources. Our results suggest that the genes responsible for virulence on PI 88788 and PI 90763 may be different alleles at a common locus. If so, rotation of cultivars with resistance from these two sources may be an effective management protocol.

| S-EPMC5345713 | biostudies-literature

The soybean GmSNAP18 gene underlies two types of resistance to soybean cyst nematode.

Project description:Two types of resistant soybean (Glycine max (L.) Merr.) sources are widely used against soybean cyst nematode (SCN, Heterodera glycines Ichinohe). These include Peking-type soybean, whose resistance requires both the rhg1-a and Rhg4 alleles, and PI 88788-type soybean, whose resistance requires only the rhg1-b allele. Multiple copy number of PI 88788-type GmSNAP18, GmAAT, and GmWI12 in one genomic segment simultaneously contribute to rhg1-b resistance. Using an integrated set of genetic and genomic approaches, we demonstrate that the rhg1-a Peking-type GmSNAP18 is sufficient for resistance to SCN in combination with Rhg4. The two SNAPs (soluble NSF attachment proteins) differ by only five amino acids. Our findings suggest that Peking-type GmSNAP18 is performing a different role in SCN resistance than PI 88788-type GmSNAP18. As such, this is an example of a pathogen resistance gene that has evolved to underlie two types of resistance, yet ensure the same function within a single plant species.

| S-EPMC5378975 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data