Detection of bacterial lipoic acid. A modified gas-chromatographic-mass-spectrometric procedure.
Ontology highlight
ABSTRACT:
SUBMITTER: Pratt KJ
PROVIDER: S-EPMC1138428 | biostudies-other | 1989 Mar
REPOSITORIES: biostudies-other
Similar Datasets
Project description:BackgroundSunscreens are one of the most widely used products among cosmetics and personal care products. Recent studies have shown that some of sunscreen formulations may contain toxic, carcinogenic, or even nonallowed chemicals that may affect skin, cells, and hormones.Materials and methodsThis study aimed to develop and validate a method that allows the determination of sunscreen ingredients by gas chromatography-mass spectrometry (GC-MS). Analysis of original sunscreen products (n=5) from a licensed pharmacy and counterfeit sunscreen products (n=5) from local markets in Jordan was performed using GC-MS. pH stability of the sunscreen samples were also monitored under different storage temperatures. Topical application of sunscreens on mice skin was conducted to study their effects on liver and kidney enzymes' function.ResultsIn terms of pH stability, there is a significant change in pH at different degrees of temperature between the products. Diethyl phthalate (DEP) was detected in two counterfeit products and was not mentioned on the ingredients' label. DEP was reported for its percutaneous absorption and systemic uptake in the literature. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly increased with a P<0.005 in some groups treated with original sunscreens under sun radiation. Creatinine showed a significant decrease in some groups treated with original and counterfeit sunscreens, while blood urea nitrogen (BUN) showed no differences.ConclusionThis study presents a method that allows the scanning and profiling of sunscreen ingredients as well as investigates their stability, permeation, and toxicity. Profiling of sunscreen product, changing in pH stability, and analyzing kidney and liver enzymes' level would be of a great impact on products' safety and consumers' health.
| S-EPMC6319425 | biostudies-literature
Project description:Earwax is a readily accessible biological matrix that has the potential to be used in disease diagnostics. However, its semisolid nature and high chemical complexity have hampered efforts to investigate its potential to reveal disease markers. This is because more conventional methods of analysis such as gas chromatography-mass spectrometry (GC-MS) and liquid chromatography-mass spectrometry yield unsatisfactory results due to the presence of many nonvolatile and/or coeluting compounds, which in some cases have very similar mass spectrometric profiles. In addition, these routine methods often require the sample to be saponified, which dramatically increases the complexity of the analysis and makes it difficult to determine which compounds are actually present versus those that are produced by saponification. In this study, two-dimensional GC mass spectrometry (GC × GC-MS) was successfully applied for the characterization of the chemical components of earwax from healthy donors using nonpolar (primary) and midpolar (secondary) columns without saponification. Over 35 of the compounds that were identified are reported for the first time to be detected in unsaponified earwax. The resulting GC × GC-MS contour plots revealed visually recognizable compound class clusters of previously reported groups including alkanes, alkenes, fatty acids, esters, triglycerides, and cholesterol esters, as well as cholesterol and squalene. The application of GC × GC-MS revealed results that provide a foundation upon which future studies aimed at comparing healthy donor earwax to that from individuals exhibiting various disease states can be accomplished.
| S-EPMC8756784 | biostudies-literature
Project description:Microsomal fractions obtained from testes of 3-week-old piglets have been incubated, separately, with progesterone, 17-hydroxyprogesterone, 5-pregnene-3 beta,20 beta-diol, 16 alpha-hydroxypregnenolone, 5-androstene-3 beta,17 alpha-diol and dehydro-epiandrosterone. The metabolites, after derivatization, have been separated by capillary gas chromatography and identified by mass spectrometry. Quantification was by selected ion monitoring. Progesterone was shown to be 17-hydroxylated and also converted into 4,16-androstadien-3-one (androstadienone). The major metabolite of 17-hydroxyprogesterone was 4-androstene-3,17-dione (4-androstenedione), but little, if any, androstadienone was formed, indicating that this particular biosynthesis did not require 17-hydroxylation. The metabolites of 5-pregnene-3 beta, 20 beta-diol were found to be 17-hydroxypregnenolone, 3 beta-hydroxy-5,16-pregnadien-20-one (16-dehydropregnenolone) and 5,16-androstadien-3 beta-ol. Dehydroepiandrosterone and 5-androstene-3 beta,17 alpha-diol were interconvertible but neither steroid acted as a substrate for 16-androstene formation. However, dehydroepiandrosterone was metabolized to a small quantity of 4-androstenedione. Under the conditions used, no metabolites of 16 alpha-hydroxypregnenolone could be detected. The present results, together with those obtained earlier, indicate that the neonatal porcine testis has the capacity to synthesize weak androgens, mainly by the 4-en-3-oxo steroid pathway. Although 16-androstenes cannot be formed from C19 steroids, progesterone served as a substrate and may be converted directly to androstadienone, without being 17-hydroxylated first. The pathway to 5,16-androstadien-3 beta-ol, however, involves 17-hydroxypregnenolone and 16-dehydropregnenolone as intermediates.
| S-EPMC1144921 | biostudies-other
Project description:Molecular probes are widely used tools in chemical biology that allow tracing of bioactive metabolites and selective labeling of proteins and other biomacromolecules. A common structural motif for such probes consists of a reporter that can be attached by copper(I)-catalyzed 1,2,3-triazole formation between terminal alkynes and azides to a reactive headgroup. Here we introduce the synthesis and application of the new thiazole-based, azide-tagged reporter 4-(3-azidopropoxy)-5-(4-bromophenyl)-2-(pyridin-2-yl)thiazole for fluorescence, UV and mass spectrometry (MS) detection. This small fluorescent reporter bears a bromine functionalization facilitating the automated data mining of electrospray ionization MS runs by monitoring for its characteristic isotope signature. We demonstrate the universal utility of the reporter for the detection of an alkyne-modified small molecule by LC-MS and for the visualization of a model protein by in-gel fluorescence. The novel probe advantageously compares with commercially available azide-modified fluorophores and a brominated one. The ease of synthesis, small size, stability, and the universal detection possibilities make it an ideal reporter for activity-based protein profiling and functional metabolic profiling.
| S-EPMC4222447 | biostudies-literature
Project description:To better understand envenoming and to facilitate the development of new therapies for snakebite victims, rapid, sensitive, and robust methods for assessing the toxicity of individual venom proteins are required. Metalloproteinases comprise a major protein family responsible for many aspects of venom-induced haemotoxicity including coagulopathy, one of the most devastating effects of snake envenomation, and is characterized by fibrinogen depletion. Snake venoms are also known to contain anti-fibrinolytic agents with therapeutic potential, which makes them a good source of new plasmin inhibitors. The protease plasmin degrades fibrin clots, and changes in its activity can lead to life-threatening levels of fibrinolysis. Here, we present a methodology for the screening of plasmin inhibitors in snake venoms and the simultaneous assessment of general venom protease activity. Venom is first chromatographically separated followed by column effluent collection onto a 384-well plate using nanofractionation. Via a post-column split, mass spectrometry (MS) analysis of the effluent is performed in parallel. The nanofractionated venoms are exposed to a plasmin bioassay, and the resulting bioassay activity chromatograms are correlated to the MS data. To study observed proteolytic activity of venoms in more detail, venom fractions were exposed to variants of the plasmin bioassay in which the assay mixture was enriched with zinc or calcium ions, or the chelating agents EDTA or 1,10-phenanthroline were added. The plasmin activity screening system was applied to snake venoms and successfully detected compounds exhibiting antiplasmin (anti-fibrinolytic) activities in the venom of Daboia russelii, and metal-dependent proteases in the venom of Crotalus basiliscus. Graphical abstract ?.
| S-EPMC6096707 | biostudies-literature
Project description:This study aimed to optimize and validate a multi-residue method for identifying and quantifying pesticides in honey by using both gas and liquid chromatographic separation followed by mass spectrometric detection. The proposed method was validated to detect 168 compounds, 127 of them by LC-MS/MS (liquid chromatography tandem mass spectrometric detection) and 41 by GC-MS/MS (gas chromatography tandem mass spectrometric detection). The limit of detection (LOD) and limit of quantification (LOQ) values for the analytes determined by LC-MS/MS were 0.0001-0.0004 mg/kg and 0.0002-0.0008 mg/kg, respectively. For GC-MS/MS analyses, the LOD and LOQ values were 0.001-0.004 mg/kg and 0.002-0.008 mg/kg. In total, 33 samples of commercial honey produced by apiaries in six Brazilian states were analyzed with the validated method. Residual amounts of 15 analytes were detected in 31 samples (93.9%). The method described in the present study was able to detect an extensive and broad range of pesticides with very high sensitivity.
| S-EPMC7599512 | biostudies-literature
Project description:Characterization of histone post-translational modifications (PTMs) is still challenging, and robust histone sample preparation is essential for convincing evaluation of PTMs by mass spectrometry. An effective protocol for extracting plant histone proteins must also avoid excessive co-extraction of the numerous potential interfering compounds, including those related to secondary metabolism. Currently, the co-existence of histone marks is addressed mostly by shotgun proteomic analysis following chemical derivatization of histone lysine residues. Here, we report a straightforward approach for plant histone sample preparation for mass spectrometry, based on filter-aided sample preparation coupled with histone propionylation. The approach offers savings in sample handling and preparation time, enables removal of interfering compounds from the sample, and does not require either precipitation or dialysis of histone extract. We show the comparison of two protocol variants for derivatization of histone proteins, in-solution propionylation in the vial and propionylation on the filter unit. For both protocols, we obtained identical abundances of post-translationally modified histone peptides. Although shorter time is required for histone protein labeling on the filter unit, in-solution derivatization slightly outweighed filter-based variant by lower data variability. Nevertheless, both protocol variants appear to be efficient and convenient approach for preparation of plant histones for mass spectrometric analysis.
| S-EPMC6156276 | biostudies-literature
Project description:Over the past decade, the number of known eicosanoids has expanded immensely and we have now developed an ultra-performance liquid chromatography-electrospray ionization triple quadrupole mass spectrometric (UPLC-QTRAP/MS/MS) method to monitor and quantify numerous eicosanoids. The UPLC-QTRAP/MS/MS approach utilizes scheduled multiple reaction monitoring (MRM) to optimize sensitivity, number of metabolites that can be analyzed and the time requirement of the analysis. A total of 184 eicosanoids including 26 deuterated internal standards can be separated and monitored in a single 5min UPLC run. To demonstrate a practical application, human plasma samples were analyzed following solid-phase extraction (SPE) and the recovery rate and matrix effects were determined for the 26 deuterated internal standards added to the plasma. The method was validated and shown to be sensitive with the limit of quantitation at pg levels for most compounds, accurate with recovery rates of 70-120%, and precise with a CV<30 for all compounds. Also, the method showed a linear response over a range spanning several orders of magnitude. In a QC human plasma sample, we identified and rigorously quantified over 120 eicosanoids.
| S-EPMC4592635 | biostudies-literature
Project description:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in ?-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ?-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ?-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.
| S-EPMC4398509 | biostudies-literature
Project description:BACKGROUND:The nucleotide reverse transcriptase inhibitor tenofovir (TFV) is widely administered in a disoproxil prodrug form (tenofovir disoproxil fumarate, TDF) for HIV management and prevention. Recently, novel prodrugs tenofovir alafenamide fumarate (TAF) and hexadecyloxypropyl tenofovir (CMX157) have been pursued for HIV treatment while minimizing adverse effects associated with systemic TFV exposure. Dynamic and sensitive bioanalytical tools are required to characterize the pharmacokinetics of these prodrugs in systemic circulation. Two parallel methods have been developed, one to combinatorially quantify TAF and TFV, and a second method for CMX157 quantification, in plasma. METHODS:K2EDTA plasma was spiked with TAF and TFV, or CMX157. Following the addition of isotopically labeled internal standards and sample extraction via solid phase extraction (TAF and TFV) or protein precipitation (CMX157), samples were subjected to liquid chromatographic-tandem mass spectrometric (LC-MS/MS) analysis. For TAF and TFV, separation occurred using a Zorbax Eclipse Plus C18 Narrow Bore RR, 2.1?×?50?mm, 3.5??m column and analytes were detected on an API5000 mass analyzer; CMX157 was separated using a Kinetex C8, 2.1?×?50?mm, 2.6??m column and quantified using an API4500 mass spectrometer. Methods were validated according to FDA Bioanalytical Method Validation guidelines. RESULTS:Analytical methods: were optimized for the multiplexed monitoring of TAF and TFV, and CMX157 in plasma. The lower limits of quantification (LLOQs) for TAF, TFV, and CMX157 were 0.03, 1.0, and 0.25?ng/mL, respectively. Calibration curves were generated via weighted linear regression of standards. Intra- and inter-assay precision and accuracy studies demonstrated %CVs???14.4% and %DEVs ??±?7.95%, respectively. Stability and matrix effects studies were also performed. All results were acceptable and in accordance with the recommended guidelines for bioanalytical methods. Assays were also applied to quantify in vivo concentrations of prodrugs and TFV in a preclinical study post-rectal administration. CONCLUSIONS:Sensitive, specific, and dynamic LC-MS/MS assays have been developed and validated for the multiplexed quantification TAF and TFV, as well as an independent assay for CMX157 quantification, in plasma. The described methods meet sufficient throughput criteria to support large research trials.
| S-EPMC5835418 | biostudies-literature