Dataset Information

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

ABSTRACT: A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.

SUBMITTER: Lane AN

PROVIDER: S-EPMC1138577 | biostudies-other | 1989 May

REPOSITORIES: biostudies-other

ACCESS DATA

Similar Datasets

Project description:The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove.

Project description:The depsipeptide DNA-intercalating antibiotic luzopeptin was studied in solution by n.m.r. methods. Two-dimensional 1H double-quantum-filtered correlation spectroscopy (DQF-COSY) and nuclear-Overhauser-effect spectroscopy (NOESY) confirm the primary structure and twofold symmetry of luzopeptin and provide details of its three-dimensional conformation in solution. Trans-annular hydrogen bonds between the glycine NH groups and carbonyl oxygen atoms have been identified in the crystalline state [Arnold & Clardy (1981) J. Am. Chem. Soc. 103, 1243-1244], and are important in maintaining an antiparallel beta-sheet conformation. The n.m.r. data indicate that the glycine NH protons are appreciably shielded from the solvent molecules, which suggests that these hydrogen bonds are maintained in solution. The orientation of the quinoline chromophores is defined by two-dimensional NOE cross-peaks that position the N-methyl group of the L-beta-hydroxyvaline residue close in space to both the quinoline H-8 and serine NH proton. This pattern of NOEs is in accord both with the chromophore configuration found in the crystal and one where the quinoline rings are aligned in a parallel manner at right-angles to the depsipeptide ring. The n.m.r. data are consistent with a hydrogen bond between the quinoline hydroxy groups and the quinoline carbonyl oxygen atoms. The pyridazine acetylmethyl groups give NOEs to the C(alpha)H groups of the beta-hydroxy-N-methylvaline residues, showing that the acetyl groups, for at least some of the time, stretch over the depsipeptide ring, occluding one face of the molecule. Both of the latter features are also found in the crystal structure. Resonances in the 13C-n.m.r. spectrum of luzopeptin have been assigned by transferring 1H assignments to their covalently bonded carbon atoms via a heteronuclear shift-correlation experiment (HETCOR). The measurement of spin-lattice relaxation times and 1H-13C NOEs at specific sites in the molecule has led us to conclude that segmental motions within the depsipeptide ring are restricted and that the 13C relaxation data for luzopeptin's protonated carbon atoms are adequately described by isotropic tumbling in solution. Furthermore, relaxation data for the carbon atoms of the quinoline chromophores show that these rings exhibit similar motion to the depsipeptide ring and are not rotating rapidly with respect to it. Taken together all the data imply that luzopeptin is fairly rigid in solution, on the time scale of molecular tumbling, and has, or can readily attain, a staple-like structure suitable for bisintercalation.(ABSTRACT TRUNCATED AT 400 WORDS)

Dataset Information

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets