Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptional activation of cKi-ras proto-oncogene resulting from retroviral promoter insertion.

ABSTRACT: Enhanced expression of the cKi-ras proto-oncogene in a bone marrow-derived mouse cell line, 416B, has been shown to be associated with the integration of Friend viral DNA into the cellular gene. Here we report the results of experiments designed to clarify the molecular mechanism responsible for the cKi-ras overexpression. Based on primer extension analyses and DNA sequencing of cKi-ras cDNA clones, we have obtained evidence that the 416B cells contain viral-host chimaeric transcripts that initiate within the 3' long terminal repeat (LTR) of the integrated provirus. Processing of the transcripts from the rearranged cKi-ras gene includes an unexpected splicing event associated with the fortuitous creation of a cryptic donor splice site at the junction between the proviral and cellular DNA sequences. These data demonstrate that enhanced cKi-ras expression in the 416B cells results from a retroviral promoter insertion mechanism of transcriptional activation.

SUBMITTER: Trusko SP

PROVIDER: S-EPMC335129 | biostudies-other | 1989 Nov

REPOSITORIES: biostudies-other

ACCESS DATA

Json Xml

Publications

Transcriptional activation of cKi-ras proto-oncogene resulting from retroviral promoter insertion.

Trusko S P SP Hoffman E K EK George D L DL

Nucleic acids research 19891101 22

Enhanced expression of the cKi-ras proto-oncogene in a bone marrow-derived mouse cell line, 416B, has been shown to be associated with the integration of Friend viral DNA into the cellular gene. Here we report the results of experiments designed to clarify the molecular mechanism responsible for the cKi-ras overexpression. Based on primer extension analyses and DNA sequencing of cKi-ras cDNA clones, we have obtained evidence that the 416B cells contain viral-host chimaeric transcripts that initi ...[more]

PMID: 2555789

Similar Datasets

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation.

Project description:Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a gamma-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A gamma-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation.

| S-EPMC2234041 | biostudies-literature

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

Project description:G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

| S-EPMC6408435 | biostudies-literature

Multiplexed and tunable transcriptional activation by promoter insertion using nuclease-assisted vector integration.

Project description:The ability to selectively regulate expression of any target gene within a genome provides a means to address a variety of diseases and disorders. While artificial transcription factors are emerging as powerful tools for gene activation within a natural chromosomal context, current generations often exhibit relatively weak, variable, or unpredictable activity across targets. To address these limitations, we developed a novel system for gene activation, which bypasses native promoters to achieve unprecedented levels of transcriptional upregulation by integrating synthetic promoters at target sites. This gene activation system is multiplexable and easily tuned for precise control of expression levels. Importantly, since promoter vector integration requires just one variable sgRNA to target each gene of interest, this procedure can be implemented with minimal cloning. Collectively, these results demonstrate a novel system for gene activation with wide adaptability for studies of transcriptional regulation and cell line engineering.

| S-EPMC6614798 | biostudies-literature

Calcineurin inhibitors activate the proto-oncogene Ras and promote protumorigenic signals in renal cancer cells.

Project description:The development of cancer is a major problem in immunosuppressed patients, particularly after solid organ transplantation. We have recently shown that calcineurin inhibitors (CNI) used to treat transplant patients may play a critical role in the rapid progression of renal cancer. To examine the intracellular signaling events for CNI-mediated direct tumorigenic pathway(s), we studied the effect of CNI on the activation of proto-oncogenic Ras in human normal renal epithelial cells (REC) and renal cancer cells (786-0 and Caki-1). We found that CNI treatment significantly increased the level of activated GTP-bound form of Ras in these cells. In addition, CNI induced the association of Ras with one of its effector molecules, Raf, but not with Rho and phosphatidylinositol 3-kinase; CNI treatment also promoted the phosphorylation of the Raf kinase inhibitory protein and the downregulation of carabin, all of which may lead to the activation of the Ras-Raf pathway. Blockade of this pathway through either pharmacologic inhibitors or gene-specific small interfering RNA significantly inhibited CNI-mediated augmented proliferation of renal cancer cells. Finally, it was observed that CNI treatment increased the growth of human renal tumors in vivo, and the Ras-Raf pathway is significantly activated in the tumor tissues of CNI-treated mice. Together, targeting the Ras-Raf pathway may prevent the development/progression of renal cancer in CNI-treated patients.

| S-EPMC2805191 | biostudies-literature

Acetylation of the proto-oncogene EVI1 abrogates Bcl-xL promoter binding and induces apoptosis.

Project description:EVI1 (Ecotropic Viral Integration site I), which was originally identified as a myeloid transforming gene by means of retroviral insertional mutagenesis in mouse leukemia, encodes a nuclear DNA binding zinc finger protein. The presence of zinc fingers that are able to bind to specific sequences of DNA suggests that EVI1 is a transcriptional regulator; however, except a few, target genes of EVI1 are poorly functionally identified thus far. In this study we provide evidence that EVI1 directly induces the expression of Bcl-xL through the first set of zinc finger and thereby inhibits apoptosis. ChIP analysis showed that EVI1 binds to the Bcl-xL promoter in HT-29 cells, a colon carcinoma cell line, which expresses EVI1. The observation is also supported by the fact that EVI1 siRNA treated HT-29 cells, shows a down regulation of Bcl-xL expression and that over expression of EVI1 results in the induction of the Bcl-xL reporter construct. A set of EVI1 positive chronic myeloid leukemia (CML) samples also showed higher Bcl-xL expression with respect to EVI1 negative samples. Interestingly, co-expression of EVI1 with wild type, but not with dominant-negative form of PCAF, abolishes the effect of EVI1 on Bcl-xL, indicating that acetylation of EVI1 abrogates its ability not only to bind Bcl-xL promoter but also alleviate Bcl-xL activity. Finally we have shown that EVI1 expression regulates apoptosis in HT-29 cells, which is abrogated when HT-29 cells are transfected with EVI1 siRNA or PCAF. The result for the first time shows a direct pathway by which EVI1 can protect cells from apoptosis and also demonstrates that the pathway can be reversed when EVI1 is acetylated.

| S-EPMC3182211 | biostudies-literature

Transcriptional regulation of the proto-oncogene Zfp521 by SPI1 (PU.1) and HOXC13.

Project description:The mouse zinc-finger gene Zfp521 (also known as ecotropic viral insertion site 3; Evi3; and ZNF521 in humans) has been identified as a B-cell proto-oncogene, causing leukemia in mice following retroviral insertions in its promoter region that drive Zfp521 over-expression. Furthermore, ZNF521 is expressed in human hematopoietic cells, and translocations between ZNF521 and PAX5 are associated with pediatric acute lymphoblastic leukemia. However, the regulatory factors that control Zfp521 expression directly have not been characterized. Here we demonstrate that the transcription factors SPI1 (PU.1) and HOXC13 synergistically regulate Zfp521 expression, and identify the regions of the Zfp521 promoter required for this transcriptional activity. We also show that SPI1 and HOXC13 activate Zfp521 in a dose-dependent manner. Our data support a role for this regulatory mechanism in vivo, as transgenic mice over-expressing Hoxc13 in the fetal liver show a strong correlation between Hoxc13 expression levels and Zfp521 expression. Overall these experiments provide insights into the regulation of Zfp521 expression in a nononcogenic context. The identification of transcription factors capable of activating Zfp521 provides a foundation for further investigation of the regulatory mechanisms involved in ZFP521-driven cell differentiation processes and diseases linked to Zfp521 mis-expression.

| S-EPMC5073027 | biostudies-literature

Allosteric activation of proto-oncogene kinase Src by GPCR-beta-arrestin complexes.

Project description:G protein-coupled receptors (GPCRs) initiate signaling cascades via G-proteins and beta-arrestins (βarr). βarr-dependent actions begin with recruitment of βarr to the phosphorylated receptor tail and are followed by engagement with the receptor core. βarrs are known to act as adaptor proteins binding receptors and various effectors, but it is unclear whether in addition to the scaffolding role βarrs can allosterically activate their downstream targets. Here we demonstrate the direct allosteric activation of proto-oncogene kinase Src by GPCR-βarr complexes in vitro and establish the conformational basis of the activation. Whereas free βarr1 had no effect on Src activity, βarr1 in complex with M2 muscarinic or β2-adrenergic receptors reconstituted in lipid nanodiscs activate Src by reducing the lag phase in Src autophosphorylation. Interestingly, receptor-βarr1 complexes formed with a βarr1 mutant, in which the finger-loop, required to interact with the receptor core, has been deleted, fully retain the ability to activate Src. Similarly, βarr1 in complex with only a phosphorylated C-terminal tail of the vasopressin 2 receptor activates Src as efficiently as GPCR-βarr complexes. In contrast, βarr1 and chimeric M2 receptor with nonphosphorylated C-terminal tail failed to activate Src. Taken together, these data demonstrate that the phosphorylated GPCR tail interaction with βarr1 is necessary and sufficient to empower it to allosterically activate Src. Our findings may have implications for understanding more broadly the mechanisms of allosteric activation of downstream targets by βarrs.

| S-EPMC7864071 | biostudies-literature

Hinge like domain motion facilitates human RBMS1 protein binding to proto-oncogene c-myc promoter.

Project description:DNA binding proteins recognize DNA specifically or non-specifically using direct and indirect readout mechanisms like sliding, hopping, and diffusion. However, a common difficulty in explicitly elucidating any particular mechanism of site-specific DNA-protein recognition is the lack of knowledge regarding target sequences and inadequate account of non-specific interactions, in general. Here, we decipher the structural basis of target search performed by the key regulator of expression of c-myc proto-oncogene, the human RBMS1 protein. In this study, we have shown the structural reorganization of this multi-domain protein required for recognizing the specific c-myc promoter sequence. The results suggest that a synergy between structural re-organization and thermodynamics is necessary for the recognition of target sequences. The study presents another perspective of looking at the DNA-protein interactions.

| S-EPMC8191779 | biostudies-literature

Proto-oncogene Pokemon in thyroid cancer: a potential promoter of tumorigenesis in papillary thyroid carcinoma.

Project description:BackgroundPokemon is an oncogenic transcription regulator that plays a critical role in cellular differentiation. Although it has been found to be overexpressed in several types of cancer involving different organs, its role in thyroid gland has yet to be reported. The objective of this study was to evaluate the expression of Pokemon in papillary thyroid carcinoma (PTC) based on clinicopathological parameters.MethodsTissue microarray samples derived from patients with PTC or benign thyroid disease were used to evaluate Pokemon expression based on immunohistochemical analysis. Correlations of its expression with various clinicopathological parameters were then analyzed.ResultsPokemon expression was observed in 22.0% of thyroid follicular cells from the normal group, 44.0% from the group with benign thyroid diseases, and 92.1% from the group with PTC (p < .001). The intensity of Pokemon expression was markedly higher in the PTC group. Pokemon expression level and PTC tumor size showed an inverse correlation. T1a tumors showed strong expression levels of Pokemon. However, larger tumors showed weak expression (p = .006).ConclusionsPokemon expression is associated with tumorigenesis of PTC, with expression showing an inverse correlation with PTC tumor size. This might be related to the negative regulation of aerobic glycolysis by Pokemon.

| S-EPMC8476314 | biostudies-literature

The Caenorhabditis elegans homologue of the proto-oncogene ect-2 positively regulates RAS signalling during vulval development.

Project description:Guanine nucleotide exchange factors (GEFs) regulate the activity of small GTP-binding proteins in a variety of biological processes. We have identified a gain-of-function mutation in the Caenorhabditis elegans GEF ect-2, the homologue of the mammalian ect2 proto-oncogene that has an essential role during cytokinesis. Here, we report that, in addition to its known function during mitosis, ECT-2 promotes the specification of the primary vulval cell fate by activating RAS/mitogen-activated protein kinase (MAPK) signalling before the end of the S-phase. Epistasis analysis indicates that ECT-2 crosstalks to the canonical RAS/MAPK cascade upstream of the RAS GEF SOS-1 by means of a RHO-1 signalling pathway. Our results raise the possibility that the transforming activity of the mammalian ect-2 oncogene could be due to hyperactivation of the RAS/MAPK pathway.

| S-EPMC1369209 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data