Dataset Information

Association between HLA-E gene polymorphism and unexplained recurrent spontaneous abortion (RSA) in Iranian women.

ABSTRACT: Human leukocyte antigen-E (HLA-E)is a non-classical major histocompatibility complex (MHC) class I antigens which expressed on extra villous cytotrophoblast, which interacts with NKG2A, is an inhibitory receptor on natural killer (NK) cells and leading to down regulation of immune response in the maternal-fetal interface and provides maternal immune tolerance of the fetus.This study was designated to investigate the gene frequencies of E0101 and E0103 in HLA-E gene in Iranian women with recurrent spontaneous abortion (RSA).Amplification Refractory Mutation System (ARMS-PCR) technique was carried out to detect polymorphism in exon 3 of the HLA-E gene in women with RSA and controls (n=200). Differences between groups were analyzed by SPSS19 software using (2) test.There was no significant difference in the allele frequencies of the HLA-E polymorphism between RSA and fertile controls but HLA-E 0101/0103 heterozygous genotype was found to be significantly higher in RSA group (p=0.006, OR=1.73), so this genotype might confer susceptibility to RSA.Our results suggest that HLA-E 0101/0103 heterozygous genotype leads to increase of RSA risk. It seems that by genotyping of HLA-E polymorphism, we can predict the risk of RSA in infertile women.

SUBMITTER: Fotoohi M

PROVIDER: S-EPMC4971558 | biostudies-other | 2016 Jul

REPOSITORIES: biostudies-other

ACCESS DATA

Publications

Association between HLA-E gene polymorphism and unexplained recurrent spontaneous abortion (RSA) in Iranian women.

Fotoohi Maryam M Ghasemi Nasrin N Mirghanizadeh Seyed Ali SA Vakili Mahmood M Samadi Morteza M

International journal of reproductive biomedicine 20160701 7

<h4>Background</h4>Human leukocyte antigen-E (HLA-E)is a non-classical major histocompatibility complex (MHC) class I antigens which expressed on extra villous cytotrophoblast, which interacts with NKG2A, is an inhibitory receptor on natural killer (NK) cells and leading to down regulation of immune response in the maternal-fetal interface and provides maternal immune tolerance of the fetus.<h4>Objective</h4>This study was designated to investigate the gene frequencies of E0101 and E0103 in HLA- ...[more]

PMID: 27525333

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Project description:BackgroundRecurrent spontaneous abortion (RSA) refers to 2 or more consecutive pregnancy losses, and RSA with unknown causes is called unexplained recurrent spontaneous abortion (URSA). Tim-3, a subtype of the T-cell immunoglobulin domain and mucin domain (Tim) protein family, might be an important regulatory molecule that plays a pivotal role in URSA, which might be triggered mostly by Th1/Th2 immune deviation. To understand the etiology and pathogenesis of URSA in Han Chinese women, we investigated the association between polymorphisms of rs10053538 and rs10515746 in the promoter of Tim-3 and the risk of URSA in Han Chinese women.MethodsOne hundred and forty-eight women with RSA resulting in still birth were enrolled in the URSA group. We performed tests to rule out congenital reproductive system malformation, reproductive system tumor, endocrine dyscrasia, and chromosome abnormalities. One hundred and fifty-three women with normal pregnancy leading to live birth were selected at random to comprise the control group. All women included in this study were genetically unrelated Han Chinese women. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele-specific polymerase chain reaction (AS-PCR) were used to determine polymorphisms of rs10053538 and rs10515746, respectively, in all subjects. PCR products were chosen at random for sequencing.ResultsNo significant statistical difference was found between the distribution frequency of the GT + TT genotype and T allele on the rs10053538 locus in the URSA group or the control group (10.1% vs. 11.8%, Chi(2) = 0.205, P = 0.651; 5.1% vs. 6.5%, Chi(2) = 0.592, P = 0.441; respectively). Neither was there a significant difference between the distribution frequency of the GT + TT genotype and T allele on the rs10515746 locus in the groups (6.8% vs. 3.9%, Chi(2)1.201, P = 0.273; 3.4% vs. 2.0%, Chi(2) = 1.169, P = 0.280; respectively).ConclusionsThe present study suggested that these polymorphisms of rs10053538 or rs10515746 in the Tim-3 promoter may not be associated with URSA in Han Chinese women.

Dataset Information

Association between HLA-E gene polymorphism and unexplained recurrent spontaneous abortion (RSA) in Iranian women.

Publications

Association between HLA-E gene polymorphism and unexplained recurrent spontaneous abortion (RSA) in Iranian women.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets