Dataset Information

Ena-DATASET-UniCal-01-05-2020-00:40:53:266-485 - samples

ABSTRACT: The plasma samples and white blood cell samples were collected from 30 non-small-cell lung cancer patients and 3 healthy individuals. The solid tumor biopsy samples from 14 patients (a subset of the 30 patients) were collected. The cfDNA was extracted from their plasma samples using the QIAamp circulating nucleic acid kit from QIAGEN (Germantown, MD). The cfDNA WES library was constructed with the SureSelect XT HS kit from Agilent Technologies (Santa Clara, CA) according to the manufacturerÃ¢Â€Â™s protocol. In brief, 10ng of cfDNA was used as input material. After end repair/dA-tailing of cfDNA, the adaptor was ligated. The ligation product was purified with Ampure XP beads (Beckman-Coulter, Atlanta, GA) and the adaptor-ligated library was amplified with index primer in 10-cycle PCR. The amplified library was purified again with Ampure XP beads, and the amount of amplified DNA was measured using the Qubit 1xdsDNA HS assay kit (ThermoFisher, Waltham, MA). 700-1000 ng of DNA sample was hybridized to the Agilent SureSelect Human All Exon V6 (Agilent) capture library and pulled down by streptavidin-coated beads. After washing the beads, the DNA library captured on the beads was re-amplified with 10-cycle PCR. The final libraries were purified by Ampure XP beads. The library concentration was measured by Qubit, and the quality was further examined with Agilent Bioanalyzer before the final step of 2x150bp paired-end sequencing on the Illumina HiSeq X10 platform (Illumina) at an average coverage of 200. Whole-exome capture libraries of genomic DNA of the 30 non-small cell lung cancer patients were constructed via Roche SeqCap EZ Exome V3 (Roche); whole-exome capture libraries of genomic DNA of the 3 healthy individuals were constructed via Agilent SureSelect Human All Exon V6 (Agilent). Enriched exome libraries were sequenced on the Illumina HiSeq 3000 platform (Illumina) to generate 2x100bp paired-end reads at an average coverage of 200.

PROVIDER: EGAD00001006096 | EGA |

REPOSITORIES: EGA

ACCESS DATA

Similar Datasets

Project description:We also collected samples from 8 NSCLC patients and 4 ovarian cancer patients and. For all 8 NSCLC patients, a tumor biopsy sample, a WBC sample, and three plasma samples were collected. For all 4 ovarian cancer patients, a WBC sample and two serum samples were collected. We collected tumor tissue sample from one ovarian cancer patient (OV4). The cfDNA was extracted from their plasma samples using the QIAamp circulating nucleic acid kit from QIAGEN (Germantown, MD). For serum cfDNA, ampure XP beads size selection was further performed to eliminate gDNA contamination. In brief, 0.5 volume of beads were first added to the cfDNA samples. After incubation, the supernatant was transferred to a new tube and an additional 2.0 volume of beads were added. After 80% ethanol wash, cfDNA was eluted from the beads. FA assays (Agilent Technologies) were performed to rule out the contamination of gDNA in the size selected samples. The cfDNA WES library of all patients and the genomic DNA WES library of the 4 ovarian cancer patients were constructed with the SureSelect XT HS kit from Agilent Technologies (Santa Clara, CA) according to the manufacturerÃ¢Â€Â™s protocol. In brief, 10ng of cfDNA was used as input material. After end repair/dA-tailing of cfDNA, the adaptor was ligated. The ligation product was purified with Ampure XP beads (Beckman-Coulter, Atlanta, GA) and the adaptor-ligated library was amplified with index primer in 10-cycle PCR. The amplified library was purified again with Ampure XP beads, and the amount of amplified DNA was measured using the Qubit 1xdsDNA HS assay kit (ThermoFisher, Waltham, MA). 700-1000 ng of DNA sample was hybridized to the capture library and pulled down by streptavidin-coated beads. After washing the beads, the DNA library captured on the beads was re-amplified with 10-cycle PCR. The final libraries were purified by Ampure XP beads. The library concentration was measured by Qubit, and the quality was further examined with Agilent Bioanalyzer before the final step of 2x150bp paired-end sequencing at an average coverage of 200. Whole-exome capture libraries of genomic DNA from the 8 NSCLC patients were constructed via Roche SeqCap EZ Exome V6 (Roche). Enriched exome libraries were sequenced on the Illumina HiSeq 3000 platform (Illumina) to generate 2x100bp paired-end reads at an average coverage of 200.

Project description:Glioblastoma stem cells (TS-543) were harvested and cross-linked with 1% formaldehyde for 10 mins at room temperature. The cells were lysed using SDS Lysis buffer for ChIP (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8). The lysate was then sonicated for 25 cycles at 30% amplitude (15 s ON and 45 s OFF). The sonicated samples were then diluted in ChIP dilution buffer (0.01% SDS, 1% Triton-X-100, 1.2 mM EDTA, 16.7 mM Tris–HCl pH 8, 167 mM NaCl) and used for the immunoprecipitation with H3K27ac (Abcam, Ab4729), H2AZ (Active motive, cat#39113) and H3K27ac (Abcam cat#ab8580). After an over-night incubation with antibody, the bound DNA was washed sequentially with low salt wash buffer (0.1% SDS, 1% Triton X 100, 2 mM EDTA, 20 mM Tris–HCl pH 8, 150 mM NaCl), high salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl pH 8, 500 mM NaCl), LiCl wash buffer (0.25 M LiCl, 1% NP40, 1%deoxycholate, 1 mM EDTA, 10 mM Tris–HCl pH 8) and TE wash buffer (10 mM Tris–HCl pH 8, 1 mM EDTA) to remove non-specific sequences and eluted in the elution buffer (84 mg NaHCO3, 1 ml 10% SDS, 9 ml H2O). Then the samples were reverse cross-linked using NaCl at 65°C overnight. The eluted DNA was purified and used for library preparation. Library preparation was performed as previously described as described in Bowman et al. BMC Genomics 2013. Briefly, end repair with NEBNext End Repair enzyme (NEB, E6050) and clean-up with 2.4x volume AMPure XP beads (Beckman Coulter, A63880). A-tailing with Klenow Fragment (NEB, M0212) and purified with 2.4x volume AMPure XP beads. Adapter ligation reactions contained annealed universal adapter and T4 rapid ligase (NEB, B0202) and clean-up with 1.8x volume AMPure XP beads. Chromatin was amplified using KAPA Real-time Library Amplification Kit (KAPABIOSYSTEMS, KK2701) with universal primer and barcoded primer. Amplified chromatin was purified with QIAquick Gel Extraction Kit (Qiagen) and sequenced paired-end with Illumina NextSeq 500.

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.

Dataset Information

Ena-DATASET-UniCal-01-05-2020-00:40:53:266-485 - samples

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets