Next Generation Children project - WGS study of patients in NICU and PICU and their families
Ontology highlight
ABSTRACT:
PROVIDER: EGAS00001003002 | EGA |
REPOSITORIES: EGA
Similar Datasets
Project description:Atypical psychosis (similar to acute and transient psychotic disorder, brief psychotic disorder) is highly heritable, but the causal genes remain unidentified. We conducted whole-genome sequencing on multiplex Japanese families with atypical psychosis. The patient group of interest shows acute psychotic features including hallucinations, delusions, and catatonic symptoms while they often show good prognosis after the onset. In addition to the next-generation analysis, HLA typing has been conveyed to check the similarity with autoimmune disease, such as systemic lupus erythematosus (SLE). Shared causal polymorphisms in the Deleted in Colorectal Carcinoma, Netrin 1 receptor (DCC) gene were found in one multiplex family with three patients, and variants in the RNA 3'-Terminal Phosphate Cyclase (RTCA) and One Cut Homeobox 2 (ONECUT2) genes were found to be shared in seven patients. Next-generation sequencing analysis of the MHC region (previously suggested to be a hot region in atypical psychosis) using HLA typing (HLA-DRB1) revealed a common vulnerability with SLE (systemic lupus erythematosus) among five patients. This finding demonstrates the shared etiology between psychotic symptoms and autoimmune diseases at the genetic level. Focusing on a specific clinical phenotype is key for elucidating the genetic factors that underlie the complex traits of psychosis.
| S-EPMC6189064 | biostudies-literature
Project description:BackgroundGenetic components contribute significantly to the cause of hearing loss. Nonsyndromic hearing loss has been shown to have high genetic heterogeneity. For families who had given birth to two nonsyndromic deaf children in succession, it seems that their deafness was highly related to genetics.ObjectivesThis study aimed to disclose the genetic causes of the subjects from the four Chinese families with two nonsyndromic deaf children in succession who failed to find the genetic etiology of the hearing loss by common deafness genetic screening (GJB2, GJB3, SLC26A4, and MT-RNR1, including 20 hot variants in 4 genes).MethodsTargeted next-generation sequencing (NGS) of 127 known deafness genes was performed in probands of four families, followed by a series of comprehensive analyses of all family members combined with a literature review of related genes.ResultsWe identified pathogenic variants in three families including c.919-2A>G/c.1985G>A in SLC26A4; c.109G>A (p.V37I) in GJB2; and m.7505T>C in MT-TS1. Sanger sequencing confirmed that these variants segregated with the hearing impairment of each family. We also identified c.331C>T/c.625-5C>T/c.5717G>A in CDH23; c.138T>C in POU3F4 in two families, in which the pathogenicity in clinical was likely pathogenic or unknown.ConclusionsUsing the NGS detection technology, we found the genetic etiology of the HL in part of deaf families. Our study provided a useful piece of information for the variant spectrum of hearing loss in Chinese families with two deaf children in succession.
| S-EPMC8123758 | biostudies-literature
Project description:BackgroundNeurodevelopmental disorders (NDDs) are a group of heterogeneous conditions, which include mainly intellectual disability, developmental delay (DD) and autism spectrum disorder (ASD), among others. These diseases are highly heterogeneous and both genetic and environmental factors play an important role in many of them. The introduction of next generation sequencing (NGS) has lead to the detection of genetic variants in several genetic diseases. The main aim of this report is to discuss the impact and advantages of the implementation of NGS in the diagnosis of NDDs. Herein, we report diagnostic yields of applying whole exome sequencing in 87 families affected by NDDs and additional data of whole genome sequencing (WGS) from 12 of these families.ResultsThe use of NGS technologies allowed identifying the causative gene alteration in approximately 36% (31/87) of the families. Among them, de novo mutation represented the most common cause of genetic alteration found in 48% (15/31) of the patients with diagnostic mutations. The majority of variants were located in known neurodevelopmental disorders genes. Nevertheless, some of the diagnoses were made after the use of GeneMatcher tools which allow the identification of additional patients carrying mutations in THOC2, SETD1B and CHD9 genes. Finally the use of WGS only allowed the identification of disease causing variants in 8% (1/12) of the patients in which previous WES failed to identify a genetic aetiology.ConclusionNGS is more powerful in identifying causative pathogenic variant than conventional algorithms based on chromosomal microarray as first-tier test. Our results reinforce the implementation of NGS as a first-test in genetic diagnosis of NDDs.
| S-EPMC8858550 | biostudies-literature
Project description:<p>Monogenic diseases are frequent causes of neonatal morbidity and mortality, and disease presentations are often undifferentiated at birth. More than 3,500 monogenic diseases have been characterized, but clinical testing is available for only some of them and many feature clinical and genetic heterogeneity. As such, an immense unmet need exists for improved molecular diagnosis in infants. Because disease progression is extremely rapid, albeit heterogeneous, in newborns, molecular diagnoses must occur quickly to be relevant for clinical decision-making. We describe 50-hour differential diagnosis of genetic disorders by whole-genome sequencing (WGS) that features automated bioinformatic analysis and is intended to be a prototype for use in neonatal intensive care units. Retrospective 50-hour WGS identified known molecular diagnoses in two children. Prospective WGS disclosed potential molecular diagnosis of a severe <i>GJB2</i>-related skin disease in one neonate; <i>BRAT1</i>-related lethal neonatal rigidity and multifocal seizure syndrome in another infant, identified <i>BCL9L</i> as a novel, recessive visceral heterotaxy gene (<i>HTX6</i>) in a pedigree, and ruled out known candidate genes in one infants. Sequencing of parents or affected siblings expedited the identification of disease gene in prospective cases. Thus, rapid WGS can potentially broaden and foreshorten differential diagnosis, resulting in fewer empirical treatments and faster progression to genetic and prognostic counseling.</p> <p>Reprinted from Saunders et. al, Rapid Whole-Genome Sequencing for Genetic Disease Diagnosis in Neonatal Intensive Care Units. Sci. Transl. Med. 4, 154ra135 (2012; <a href="http://www.ncbi.nlm.nih.gov/pubmed?term=Rapid%20Whole-Genome%20Sequencing%20for%20Genetic%20Disease%20Diagnosis%20in%20Neonatal%20Intensive%20Care%20Units">PMID: 23035047</a>) with permission from AAAS.</p>
| phs000564 | dbGaP
Project description:The mutation spectrum of deafness genes may vary in different ethnical groups. In this study, we investigated the genetic etiology of nonsyndromic deafness in four consanguineous and two multiplex Uyghur families in which mutations in common deafness genes GJB2, SLC26A4 and MT-RNR1 were excluded. Targeted next-generation sequencing of 97 deafness genes was performed in the probands of each family. Novel pathogenic mutations were identified in four probands including the p.L416R/p.A438T compound heterozygous mutations in TMC1, the homozygous p.V1880E mutation in MYO7A, c.1238delT frameshifting deletion in PCDH15 and c.9690+1G>A splice site mutation in MYO15A. Co-segregation of the mutations and the deafness were confirmed within each family by Sanger sequencing. No pathogenic mutations were identified in one multiplex family and one consanguineous family. Our study provided a useful piece of information for the genetic etiology of deafness in Uyghurs.
| S-EPMC4444116 | biostudies-literature
Project description:Causative germline mutations in mismatch repair (MMR) genes can only be identified in ~50% of families with a clinical diagnosis of the inherited colorectal cancer (CRC) syndrome hereditary nonpolyposis colorectal cancer (HNPCC)/Lynch syndrome (LS). Identification of these patients are critical as they are at substantially increased risk of developing multiple primary tumors, mainly colorectal and endometrial cancer (EC), occurring at a young age. This demonstrates the need to develop new and/or more thorough mutation detection approaches. Next-generation sequencing (NGS) was used to screen 22 genes involved in the DNA MMR pathway in constitutional DNA from 14 HNPCC and 12 sporadic EC patients, plus 2 positive controls. Several softwares were used for analysis and functional annotation. We identified 5 exonic indel variants, 42 exonic nonsynonymous single-nucleotide variants (SNVs) and 1 intronic variant of significance. Three of these variants were class 5 (pathogenic) or class 4 (likely pathogenic), 5 were class 3 (uncertain clinical relevance) and 40 were classified as variants of unknown clinical significance. In conclusion, we have identified two LS families from the sporadic EC patients, one without a family history of cancer, supporting the notion for universal MMR screening of EC patients. In addition, we have detected three novel class 3 variants in EC cases. We have, in addition discovered a polygenic interaction which is the most likely cause of cancer development in a HNPCC patient that could explain previous inconsistent results reported on an intronic EXO1 variant.
| S-EPMC4864822 | biostudies-literature
Project description:NGPS is a method for de-novo, full-length protein sequencing in high throughput. The method is based on cleavage of the protein at semi-random sites by microwave-assisted acid hydrolysis (MAAH), enrichment of LC-MS/MS amenable peptides from the hydrolysate by solid-phase-extraction, LC-MS/MS analysis, de-novo long peptide tag sequencing of resulting peptides and assembly of peptide tags into consensus contigs.
2017-04-03 | PXD003804 | Pride
Project description:Purpose:Inherited retinal diseases (IRDs) are clinically and genetically heterogeneous showing progressive retinal cell death which results in vision loss. IRDs include a wide spectrum of disorders, such as retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), cone-rod dystrophy (CRD), and Stargardt disease (STGD1). Methods:In this study, we performed targeted next-generation sequencing based on molecular inversion probes (MIPs) that allowed the sequence analysis of 108 IRD-associated genes in 50 Iranian IRD probands. Results:The sequencing and variant filtering led to the identification of putative pathogenic variants in 36 out of 50 (72%) probands. Among 36 unique variants, we identified 20 novel variants in 15 genes. Four out of 36 probands carry compound heterozygous variants, and 32 probands carry homozygous variants. Conclusions:Employing a cost-effective targeted next-generation sequencing procedure, we identified the genetic causes of different retinal disorders in the majority of Iranian families in this study.
| S-EPMC6377375 | biostudies-literature
Project description:BackgroundThalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene.MethodsNext-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis.ResultsNGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed.ConclusionFive novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.
| S-EPMC8683637 | biostudies-literature
Project description:We have done next generation sequencing of optically thin, exponentialy growing Phaeodactylum tricornutum cultures grown with and without nitrogen source to improve our undestanding of the pathways regulation under conditions that promote lipid accumulation (N-starvation). 3 biologically independent exponentially growing culture of Phaeodactylum tricornutum were pelleted and washed several times with N-free media. Each culture was devided to 2 replicates with initial cell concentration of 2X105 cells/mL, one with NaNO3 as nitrogen source and the other without any nitrogen source. The cuture were bubbled foro 48 hours and sampled for transcriptome together with other physiological parameters and lipid analysis.
2015-01-02 | E-GEOD-56346 | biostudies-arrayexpress