Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Single-cell RNA sequencing resolves cellular heterogeneity throughout embryonic development of the thymus

ABSTRACT: This dataset consists of single-cell RNA-seq (Drop-seq) data from eight days of mouse thymus development. Samples span from embryonic day 12.5, when the thymus coalesces, until birth. They cover the whole thymus, including mesenchyme, endothelium, epithelium, thymocytes, and other lymphocytes. The dataset also includes Drop-seq data on Rag1-/- embryos and on fetal thymic organ cultures (control and a retinoic acid perturbation).

ORGANISM(S): Mus musculus

PROVIDER: GSE107910 | GEO | 2018/06/05

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Inferring population dynamics from single-cell RNA-sequencing time-series data

Project description:This dataset consists of single-cell RNA-seq (Drop-seq) data from thymi of day 14.5 mouse embryos. The sample includes the whole thymus, including mesenchyme, endothelium, epithelium, thymocytes, and other lymphocytes. The mouse is a Rag2-/- knockout.

2019-02-15 | GSE126579 | GEO

Drop-Seq analysis of mixtures of human (HEK) and mouse (3T3) cells (1000/100 STAMPs) at 12.5 cells per microliter

Project description:A cell supsension containing an equal mix of HEK and 3T3 cells was used in Drop-Seq, a novel technology for high-throughput single cell mRNAseq. Cells were mixed at a final concentration of 12.5 cells per microliter in droplets.

2015-05-20 | GSE66693 | GEO

Drop-Seq analysis of mixtures of human (HEK) and mouse (3T3) cells (1000/100 STAMPs) at 12.5 cells per microliter

2015-05-20 | E-GEOD-66693 | biostudies-arrayexpress

The thymocyte-specific RNA-binding protein Arpp21 provides TCR repertoire diversity by binding to the 3'-UTR and promoting Rag1 mRNA expression

Project description:The regulation of thymocyte development by RNA-binding proteins (RBPs) is largely unexplored. We identified 642 RBPs in the thymus and focused on Arpp21, which shows selective and dynamic expression in early thymocytes. Arpp21 was downregulated in response to T cell receptor (TCR) and Ca2+ signals. Downregulation required Stim1/Stim2 and CaMK4 expression and involved Arpp21 protein phosphorylation, polyubiquitination and proteasomal degradation. Arpp21 directly bound RNA through its R3H domain, with a preference for uridine-rich motifs, promoting the expression of target mRNAs. Analysis of the Arpp21-bound transcriptome revealed strong interactions with the Rag1 3'-UTR. Arpp21-deficient thymocytes showed reduced Rag1 expression, delayed TCR rearrangement and a less diverse TCR repertoire. This phenotype was recapitulated in Rag1 3'-UTR mutant mice harboring a deletion of the Arpp21 response region. These findings show how thymocyte-specific Arpp21 promotes Rag1 expression to enable TCR repertoire diversity until signals from the TCR terminate Arpp21 and Rag1 activities.

2023-03-31 | MSV000091606 | MassIVE

RNA Capture-Seq resolves the deep complexity of the human transcriptome (454)

Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/

2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress

RNA Capture-Seq resolves the deep complexity of the human transcriptome (Illumina)

Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic gene deserts. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/

2011-09-12 | E-GEOD-29038 | biostudies-arrayexpress

Single-cell RNA sequencing resolves cellular heterogeneity throughout embryonic development of the thymus

Project description:Single-cell RNA sequencing resolves cellular heterogeneity throughout embryonic development of the thymus

| PRJNA421909 | ENA

Mus musculus

Project description:Lmx1b ChIP-seq dataset in embryonic day 12.5 (e12.5) wild type mouse limb buds

| PRJNA327925 | ENA

An anti-silencer- and SATB1-dependent chromatin hub regulates Rag1 and Rag2 gene expression during thymocyte development

Project description:Rag1 and Rag2 gene expression in CD4+CD8+ double positive (DP) thymocytes depends on the activity of a distant anti-silencer element (ASE) that counteracts the activity of an intergenic silencer. However, the mechanistic basis for ASE activity is unknown. Here we show that the ASE physically interacts with the distant Rag1 and Rag2 gene promoters in DP thymocytes, bringing the two promoters together to form an active chromatin hub. Moreover, we show that the ASE functions as a classical enhancer that can potently activate these promoters in the absence of the silencer or other locus elements. In thymocytes lacking the chromatin organizer SATB1, we identified a partial defect in Tcra gene rearrangement that was associated with reduced expression of Rag1 and Rag2 at the DP stage. SATB1 binds to the ASE and Rag promoters, facilitating inclusion of Rag2 in the chromatin hub and the loading of RNA polymerase II to both the Rag1 and Rag2 promoters. Our results provide a novel framework for understanding ASE function and demonstrate a novel role for SATB1 as a regulator of Rag locus organization and gene expression in DP thymocytes. Sequencing of Satb1-ChIP and input control from 6 wk old thymus

2015-02-25 | E-GEOD-66248 | biostudies-arrayexpress

RAG1 targeting in the genome is dominated by chromatin interactions mediated by the non-core regions of RAG1 and RAG2

Project description:The RAG1/RAG2 endonuclease initiates V(D)J recombination at antigen receptor loci but also binds to thousands of places outside of these loci. RAG2 localizes directly to lysine 4 trimethylated histone 3 (H3K4me3) through a PHD finger. The relative contribution of RAG2-dependent and RAG1-intrinsic mechanisms in determining RAG1 binding patterns is not known. Through analysis of deep RAG1 ChIP-seq data, we provide a quantitative description of the forces underlying genome-wide targeting of RAG1. Surprisingly, sequence-specific DNA binding contributes minimally to RAG1 targeting outside of antigen receptor loci. Instead, RAG1 binding is driven by two distinct modes of interaction with chromatin: the first is driven by H3K4me3, promoter-focused, and dependent on the RAG2 PHD, and the second is defined by H3K27Ac, enhancer-focused, and dependent on "non-core" portions of RAG1. Based on this and additional chromatin and genomic features, we formulated a predictive model of RAG1 targeting to the genome. RAG1 binding sites predicted by our model correlate well with observed patterns of RAG1-mediated breaks in human pro-B acute lymphoblastic leukemia. Overall, this study provides an integrative model for RAG1 genome-wide binding and off-target activity, and reveals a novel role for the RAG1 non-core region in RAG1 targeting. ChIP-seq profiles of RAG1 from mouse thymocytes, and H3K27Ac from human REH cell line

2016-07-06 | E-GEOD-84052 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data