Dataset Information

Effects of gene-by-environment interaction on the H3K4me3 profile in the light of differential susceptibility

ABSTRACT: Purpose: Investigation of effects of early adversity in mice deficient for serotonin transporter on H3K4me3 enrichment in the context of differential susceptibility Methods: Following prenatal stress and behavioural screening in adulthood, 3 month old females, either wildtype or carrying a heterozygous knockout of the serotonin transporter gene, were sacrificed, brains extracted, the hippocampi of both hemispheres dissected, blended and separated in two protions. For one of these portions the material was split again in two portions, of which one was fixed using 1% PFA, and was subsequently processed using a standard Chromatin immuno precipitation protocol. Following ChIP, the samples were processed by Nxt-Dx Belgium. Library preparation was performed using the NEBNext Ultra II DNA Library prep kit for Illumina (NEB, Ipswitch, Massatchusettes, USA). Subsequently, the whole IP material was subjected to ends prep and ligation of Illumina adaptors. A clean up of the adaptor-ligated DNA with AMPure XP beads (Beckman Coulter) was performed without size selection. The eluted material was subjected to enrichment PCR (14 cycles) with the NEBNext Index primers, and a last clean up with AMPure XP beads followed. The quality of the final libraries was checked on a Bioanalyzer 2100 DNA 1000 chip (Agilent, Santa Clara, CA, USA). The concentration was determined by performing qPCR on the samples using a dilution of PhiX index3 as standard. The concentration of all indexed samples was adjusted to 10 nM and samples were pooled for sequencing. Sequencing was performed on an Illumina HiSeq4000 (read-length of 50 bp with 25-30 million reads/sample, paired-end). Results: dependent on the serotonin transporter genotype and behaviourally determined susceptibility to early life adversity, animals displayed distinct H3K4me3 enrichment. As expected, the effect sizes and significances were rather subtle. Conclusion: the epigenetic regulation by prenatal stress seems to be modulated by the serotonin transporter genotype

ORGANISM(S): Mus musculus

PROVIDER: GSE109928 | GEO | 2024/01/27

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Glioblastoma stem cells (TS-543) were harvested and cross-linked with 1% formaldehyde for 10 mins at room temperature. The cells were lysed using SDS Lysis buffer for ChIP (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8). The lysate was then sonicated for 25 cycles at 30% amplitude (15 s ON and 45 s OFF). The sonicated samples were then diluted in ChIP dilution buffer (0.01% SDS, 1% Triton-X-100, 1.2 mM EDTA, 16.7 mM Tris–HCl pH 8, 167 mM NaCl) and used for the immunoprecipitation with H3K27ac (Abcam, Ab4729), H2AZ (Active motive, cat#39113) and H3K27ac (Abcam cat#ab8580). After an over-night incubation with antibody, the bound DNA was washed sequentially with low salt wash buffer (0.1% SDS, 1% Triton X 100, 2 mM EDTA, 20 mM Tris–HCl pH 8, 150 mM NaCl), high salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl pH 8, 500 mM NaCl), LiCl wash buffer (0.25 M LiCl, 1% NP40, 1%deoxycholate, 1 mM EDTA, 10 mM Tris–HCl pH 8) and TE wash buffer (10 mM Tris–HCl pH 8, 1 mM EDTA) to remove non-specific sequences and eluted in the elution buffer (84 mg NaHCO3, 1 ml 10% SDS, 9 ml H2O). Then the samples were reverse cross-linked using NaCl at 65°C overnight. The eluted DNA was purified and used for library preparation. Library preparation was performed as previously described as described in Bowman et al. BMC Genomics 2013. Briefly, end repair with NEBNext End Repair enzyme (NEB, E6050) and clean-up with 2.4x volume AMPure XP beads (Beckman Coulter, A63880). A-tailing with Klenow Fragment (NEB, M0212) and purified with 2.4x volume AMPure XP beads. Adapter ligation reactions contained annealed universal adapter and T4 rapid ligase (NEB, B0202) and clean-up with 1.8x volume AMPure XP beads. Chromatin was amplified using KAPA Real-time Library Amplification Kit (KAPABIOSYSTEMS, KK2701) with universal primer and barcoded primer. Amplified chromatin was purified with QIAquick Gel Extraction Kit (Qiagen) and sequenced paired-end with Illumina NextSeq 500.

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.

Dataset Information

Effects of gene-by-environment interaction on the H3K4me3 profile in the light of differential susceptibility

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets