Small RNA seq in ALKBH3 stable over expresion and control HeLa cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE113490 | GEO | 2021/04/21
REPOSITORIES: GEO
Similar Datasets
Project description:Total RNA (100 μg) were denatured at 70 °C for 5 min and separated by a 15% TBE-Urea gel with 20/100 or 10/60 oligo length standard ladder (Integrated DNA Technologies, Coralville, IA). After visualized by SYBR Gold (Ref. S11494 from Life Technologies), tRFs in gels were cut according to sizes and recovered by small RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA). The recovered tRFs was used to establish the library by NEB small RNA library preparation kit (E7330S).
2021-04-09 | GSE112871 | GEO
Project description:Total RNA (100 μg) were denatured at 70 °C for 5 min and separated by a 15% TBE-Urea gel with 20/100 or 10/60 oligo length standard ladder (Integrated DNA Technologies, Coralville, IA). After visualized by SYBR Gold (Ref. S11494 from Life Technologies), tRFs in gels were cut according to sizes and recovered by small RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA). The recovered tRFs was used to establish the library by NEB small RNA library preparation kit (E7330S).
2021-04-21 | GSE113491 | GEO
Project description:Total RNA (100 μg) were denatured at 70 °C for 5 min and separated by a 15% TBE-Urea gel with 20/100 or 10/60 oligo length standard ladder (Integrated DNA Technologies, Coralville, IA). After visualized by SYBR Gold (Ref. S11494 from Life Technologies), tRFs (15~50 nt) in gels were cut according to sizes and recovered by small RNA PAGE recovery kit (Zymo Research, Irvine, CA, USA). The recovered tRFs was used to establish the library by NEB small RNA library preparation kit (E7330S).
2021-04-09 | GSE112870 | GEO
Project description:The CLIP procedures were conducted using HeLa cells according to the previous study (Liu et al., 2016) with slight modifications. Briefly, 4 plates of HeLa cells in 15 cm dishes were transfected with pPB/ALKBH3 plasmid for 48 h to reach about 90% cell confluency. After washing twice with ice-cold PBS, cells were irradiated twice with 400 mJ/cm2 at 254 nm by Stratalinker on ice. Cells were lysed in high salt lysis buffer (300 mM NaCl, 0.2% NP-40, 20 mM Tris-HCl PH 7.6, 0.5 mM DTT, protease inhibitor cocktail (1 tablet/50 ml), and RNase inhibitor (1:200)) at 4°C for 30 min. Supernatant was collected after centrifuged at 17,000 g at 4°C for 15 min and further treated with 1 U RNase T1 for 15 min at 24 °C. After centrifugation and filtration through 0.22 µM filter, 10% supernatant was collected as input for further sequencing analysis. Anti-Flag M2 beads (Sigma-Aldrich, St. Louis, MO, 80 μl) were washed three times with lysis buffer and incubated with the filtered supernatant at 4°C for 4 hrs. After removing the flow through by magnetic rack, beads and input were further incubated with 10 U RNase T1 exactly for 8 min. Samples were treated with 95 µL commercial PNK buffer and 0.5 U PNK for 15 min at 37 °C. After treatments, final concentration of 100 µM ATP and 1 U PNK were added and incubated at 37 °C for another 30 min. The RNA/protein complexes were eluted by NuPAGE 1 × loading buffer and fractionated by neutral NuPAGE 4–12% bis-tris gel. After cutting the gel, RNAs were recovered by proteinase K digestion in proteinase K buffer, followed by phenol/chloroform extraction using glycogen as carrier. The RNA fragments were ligated to adapter and established library by NEB small RNA library preparation kit (E7330S).
2022-03-01 | GSE112625 | GEO
Project description:Purpose: In addition to developing antivirals targeting specific SARS-CoV-2 viral proteins, there has been a growing effort in developing therapeutics targeting host proteins exploited by SARS-CoV-2 for their replication or implicated in viral pathogenesis. As such therapeutics can impair normal functioning of host proteins, a clear understanding of their impact on cellular mechanisms is critically important. Here, we characterized the interactions of a host-targeted anti-SARS-CoV-2 therapeutic, SNX-5422, with the cellular machinery using a physiologically relevant ex vivo human primary tracheobronchial epithelial (TBE) cell model. Methods: Fully differentiated human TBE cells (EpiAirwayTM) from 3 independent donors with no reported respiratory disease or smoking history were obtained from MatTek (Ashland, MA). The cells were cultured at the air-liquid interface in 1 ml of AIR-100-MM culture medium (MatTek) in 6 well plates at 37°C in 5% CO2. Upon receipt of cells, the cultures were acclimated for 16-24hr prior to the start of experiments. Human TBE cells from each donor were treated with 1µM SNX-5422 or 0.1% DMSO added to the media on the basolateral side of the culture, in three biological replicates. After 48hrs, cells were resuspended in TRIzol reagent (Thermo Fisher) and total RNA from the cells was extracted by phase separation with chloroform and subsequently using the RNeasy Mini Kit (Qiagen). RNA-Seq libraries were prepared using TruSeq RNA library Prep Kit v2 (Illumina, Inc. USA). Before pooling and sequencing, fragment length distribution and library quality were assessed on a TapeStation 2200 (Agilent Technologies), and the libraries were validated by Qubit Fluorometers (Thermo Fisher). All libraries were then pooled in a concentration at 4nM and sequenced in quadruplets on a NextSeq 500 Illumina sequencing platform system using NextSeq 500/550 High Output Kit v2.0 (150 cycles) (Illumina, Inc. USA). Conclusion: This study identified differentially expressed genes between DMSO-treated and SNX-5422-treated human TBE cells.
2022-03-04 | GSE166397 | GEO
Project description:A total of 286 synthetic miRNAs that are commonly observed in circulation were synthesized by Integrated DNA Technologies (Coralville, IA).
2017-02-16 | GSE94912 | GEO
Project description:The gene expression of bone marrow Hdc-/- and WT (LSK, Lin-c-kit+Sca-1+) hematopoetic stem and progenitor cells were isolated from Hdc-/- or WT mice. Cells were sorted by the cell surface markers of LSK total RNA was isolated from sorted 2,000 HSPCs using the ARCTURUS PicoPure RNA isolation kit (Life Technologies). cDNA was amplified and libraries were constructed by using the SMARTer Ultra Low Input RNA kit (Clontech Laboratories) and the Nextera XT DNA Library Preparation kit (Illumina) according to the respective manufacturer’s instructions. Sequencing was performed on the Illumina HiSeq2500 platform.
2019-04-09 | GSE80284 | GEO
Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies,<br><br>Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).
2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress
Project description:Total RNAs from exosomes was used for miRNA library preparation and sequencing.The preparation and sequencing of exosome miRNA were performed by Ribobio (Guangzhou, China). First, total RNA samples were fractionated by using 15% Tris-borate-EDTA (TBE) polyacrylamide gel (Invitrogen), then small RNAs ranging from 18 to 30 nucleotides were used for library preparation. Amplification of these small RNAs was then accomplished by PCR. Next, the Illumina HiSeq 2500 platform was used to sequence these RNAs.
2019-04-25 | GSE128278 | GEO
Project description:CD3+ T cells were enriched using the EasySep human T cell isolation kit (Stem cell technology). T cells from normal controls or patients with CARD9 mutations were co-cultured with monocytes of one normal control in the presence of heat killed candida. After 3 days, T cell were enriched again to remove the monocytes and total RNA was extracted from the T cells for the RNA-sequencing (RNASeq) evaluation. Targeted RNA sequencing library preparation was carried out using the Ion AmpliSeq Transcriptome Human Gene Expression Kit (Life Technologies), which profiles more than 20,000 human genes; each amplicon (~150 bp) represents a unique targeted gene (one transcript per gene). For library preparation, each sample was run in duplicate, and a cDNA library was generated from a minimum of 10 ng of total RNA. The cDNA was barcoded and amplified with Ion AmpliSeq technology, and the amplified cDNA Libraries were evaluated for quality and quantified with Agilent Bioanalyzer high-sensitivity chip. Libraries were then diluted to 100 pM and pooled equally, with 4 individual samples per pool. Pooled libraries were amplified and enriched with the Ion Chef System (Life Technologies). Templated libraries were then sequenced on an Ion Torrent Proton sequencing system (Life Technologies) with Ion PI HiQ kit and chip version 3. We performed gene-level differential expression analysis of targeted RNASeq data using R (v.3.5.3) and the Bioconductor packages DESeq2 (v.1.22.2).
2021-08-12 | GSE181718 | GEO