Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profile of 22RV1 prostate cancer cells upon SPINK1 knockdown

ABSTRACT: Serine Peptidase Inhibitor, Kazal type 1 (SPINK1) overexpression represents the second-largest prostate cancer (PCa) subtype associated with increased risk of biochemical recurrence and poor prognosis. To determine the pathways regulated by SPINK1 in 22RV1 prostate cancer cells, we performed shRNA mediated knockdown of SPINK1 using lentiviral constructs. Scrambled shRNA was used as a control. pGIPZ constructs against SPINK1 (shSPINK1-1, shSPINK1-2, shSPINK1-3) and control shScrambled construct were purchased from Dharmacon.

ORGANISM(S): Homo sapiens

PROVIDER: GSE124345 | GEO | 2019/12/16

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

22RV1 prostate cancer cell line transfected with SPINK1 siRNA vs control siRNA

Project description:ETS gene fusions have been characterized in a majority of prostate cancers, however key molecular alterations in ETS negative cancers are unclear. Here we used an outlier meta-analysis (meta-COPA) to identify SPINK1 outlier-expression exclusively in a subset of ETS rearrangement negative cancers (~10% of total cases). We validated the mutual exclusivity of SPINK1 expression and ETS fusion status, demonstrated that SPINK1 outlier-expression can be detected non-invasively in urine and observed that SPINK1 outlier-expression is an independent predictor of biochemical recurrence after resection. We identified the aggressive 22RV1 cell line as a SPINK1 outlier-expression model, and demonstrate that SPINK1 knockdown in 22RV1 attenuates invasion, suggesting a functional role in ETS rearrangement negative prostate cancers. Keywords: Genetic Modification 22RV1 cells were infected with non-targeting siRNA or siRNA against SPINK1. For reported hybridizations, the reference channel is 22RV1 cells infected with non-targeting siRNA. Duplicate hybridizations were performed with duplicate dye flips, for a total of four arrays. Over and under-expressed signatures were generated by filtering to include only features with significant differential expression (PValueLogRatio < 0.01) in all hybridizations and Cy5/Cy3 ratios > or < 1 in all hybridizations.

2008-06-10 | E-GEOD-11132 | biostudies-arrayexpress

22RV1 prostate cancer cell line transfected with SPINK1 siRNA vs control siRNA

2008-06-10 | GSE11132 | GEO

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Gene expression profile of 22RV1 prostate cancer cells upon SPINK1 knockdown

Project description:Gene expression profile of 22RV1 prostate cancer cells upon SPINK1 knockdown

| PRJNA511709 | ENA

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

2013-05-10 | GSE46329 | GEO

Transcriptomic Reprogramming of Prostate Cancer Cells Driven by Stroma-Derived SPINK1

Project description:Recent advances in next generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways and responses. We performed this study to investigate the transcriptome profiling (RNA-seq) of prostate cancer cells upon in vitro treatment with the conditioned media from prostate stromal cells exogenously expressing human SPINK1.

2018-08-30 | GSE108545 | GEO

Polycomb Group protein EZH2-mediated transcriptional repression of microRNA-338/-421 drives SPINK1-positive prostate cancer

Project description:SPINK1 overexpression defines the second largest subtype of prostate cancer (PCa), however molecular mechanisms underlying its upregulation remains poorly understood. Here, we identified the role of miR-338-5p and miR-421 in post-transcriptional regulation of SPINK1. We established that miR-338-5p/miR-421 mediates several cellular responses against SPINK1-positive cancer by targeting oncogenic long non-coding RNA (lncRNA) MALAT1, inducing cell-cycle arrest, inhibiting epithelial-to-mesenchymal transition (EMT), cancer-stemness and drug resistance. Moreover, ectopic expression of miR-338-5p/miR-421 abrogates SPINK1-mediated oncogenesis, tumor growth and distant metastases in murine model. Importantly, RNA-sequencing expression analysis revealed an inverse correlation between miRNAs and SPINK1 or MALAT1 in PCa patients’ specimens. Further, we demonstrate Polycomb group protein EZH2-mediated epigenetic silencing of miR-338-5p/miR-421 in SPINK1-positive subtype. Thus, restoring miR-338-5p/miR-421 expression using epigenetic drugs or synthetic mimics could abrogate SPINK1-mediated oncogenesis by targeting multiple oncogenic pathways and eliciting anti-cancer pleiotropic effects. Taken together, the present study unravels the molecular mechanism underlying SPINK1 overexpression and suggests miR-338-5p and miR-421 replacement therapy for the treatment of SPINK1-positive malignancies.

2018-12-30 | GSE108558 | GEO

SPINK1 promotes Colorectal Cancer progression by down regulating Metallothioneins expression

Project description:Expression profiling was performed using Agilent Whole Human Genome Oligo Microarray (Santa Clara, CA) according to the manufacturer’s protocol. A total of 3 microarray hybridizations were performed using each stable shSPINK1 cell line samples against control shSCRM cells. SPINK1 gene was knocked down using shRNA in WIDR cells in the experimental group and shScramble cells were used as control.

2015-07-11 | E-GEOD-70761 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Dynamics of genomic, epigenomic, and transcriptomic aberrations during stepwise hepatocarcinogenesis

Project description:Hepatocellular carcinoma (HCC) undergoes a stepwise progression from liver cirrhosis (LC) to low-grade dysplastic nodule (LGDN), high-grade dysplastic nodule (HGDN), early HCC (eHCC), and progressed HCC (pHCC). Here, we profiled multi-layered genomic, epigenomic, and transcriptomic aberrations in the stepwise hepatocarcinogenesis. Initial DNA methylation was observed in eHCC (e.g., DKK3, SALL3, and SOX1) while more extensive methylation was observed in pHCC. In addition, eHCCs showed an initial loss of DNA copy numbers of tumor suppressor genes in the 4q and 13q regions, thereby conferring survival benefits to cancer cells. Transcriptome analysis revealed that HGDNs expressed endoplasmic reticulum (ER) stress-related genes, while eHCC started to express oncogenes. Furthermore, integrative analysis indicated that expression of the serine peptidase inhibitor, Kazal type 1 (SPINK1), played a pivotal role in eHCC development. Significant demethylation of SPINK1 was observed in eHCC compared to HGDN. The study also demonstrated that ER stress may induce SPINK1 demethylation and expression in liver cancer cells. In conclusion, these results reveal the dynamics of multiomic aberrations during malignant conversion of liver cancer, thus providing novel pathobiological insights into hepatocarcinogenesis.

2019-09-18 | GSE99036 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data