Metastatic breast cancer to the brain: set 1
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE14682 | GEO | 2009/02/11
SECONDARY ACCESSION(S): PRJNA114425
REPOSITORIES: GEO
Similar Datasets
Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients.
2009-02-11 | GSE14683 | GEO
Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5μm thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin Kit® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDrop® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50°C for 2 minutes, 95°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95°C for 20 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.
2010-06-24 | E-GEOD-14682 | biostudies-arrayexpress
Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients. An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5μm thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin Kit® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDrop® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50°C for 2 minutes, 95°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95°C for 20 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.
2010-06-24 | E-GEOD-14683 | biostudies-arrayexpress
Project description:HER3 (ErbB3) belongs to a family of receptor tyrosine kinases together with the known oncogenes EGFR and HER2. Recently, antibody drug conjugates (ADCs) targeting these receptors showed promising clinical activity in extracranial malignancies of breast and lung cancer. We aimed to investigate HER3 expression in breast and lung cancer brain metastases (BM) as the basis for future clinical trial design. Illumina MethylationEPIC 850k microarrays were used to analyze genome-wide DNA methylation patterns of HER3-positive (n=43) and HER3-negative (n=28) BM.
2023-03-31 | GSE220826 | GEO
Project description:The tyrosine kinase receptors HER2 and HER3 play an important role in breast cancer. The HER2/HER3 heterodimer is a critical oncogenic unit associated with reduced relapse-free and decreased overall survival. We provide gene expression profile of the mammary epithelial cells MCF10A expressing HER2, HER3 or HER2/HER3 and grown in three-dimensional cultures for 15 days in the presence of heregulin, a known HER3-ligand that stabilizes and activates the HER2/HER3 heterodimer.
2012-09-01 | GSE37009 | GEO
Project description:The tyrosine kinase receptors HER2 and HER3 play an important role in breast cancer. The HER2/HER3 heterodimer is a critical oncogenic unit associated with reduced relapse-free and decreased overall survival. We provide gene expression profile of the mammary epithelial cells MCF10A expressing HER2, HER3 or HER2/HER3 and grown in three-dimensional cultures for 15 days in the presence of heregulin, a known HER3-ligand that stabilizes and activates the HER2/HER3 heterodimer. The mammary epithelial cells MCF10A were transduced with retroviral vectors expressing HER2, HER3 or both. Cells from each group were grown for 15 days in three-dimensional cultures. At the end of the experiment, RNA was extracted for gene expression analysis.
2012-09-01 | E-GEOD-37009 | biostudies-arrayexpress
Project description:DUSP6 inhibition overcomes neuregulin/HER3-driven therapy tolerance in HER2+ breast cancer
| PRJNA966201 | ENA
Project description:Brain metastases are an increasing burden among breast cancer patients, particularly for those with HER2+ and triple negative (TN) subtypes. Mechanistic insight into the pathophysiology of brain metastases and preclinical validation of therapies has relied almost exclusively on intracardiac injection of brain-homing cells derived from highly aggressive TN MDA-MB-231 and HER2+ BT474 breast cancer cell lines. Yet, these well characterized models are far from representing the tumor heterogeneity observed clinically and, due to their fast progression in vivo, their suitability to validate therapies for established brain metastasis remains limited. The goal of this study was to develop and characterize novel human brain metastasis breast cancer patient-derived xenografts (BM-PDXs) to study the biology of brain metastasis and to serve as tools for testing novel therapeutic approaches. We obtained freshly resected brain metastases from consenting donors with breast cancer. Tissue was immediately implanted in the mammary fat pad of female immunocompromised mice and expanded as BM-PDXs. Brain metastases from 3/4 (75%) TN, 1/1 (100%) estrogen receptor positive (ER+), and 5/9 (55.5%) HER2+ clinical subtypes were established as transplantable BM-PDXs. To facilitate tracking of metastatic dissemination using BM-PDXs, we labeled PDX-dissociated cells with EGFP-luciferase followed by re-implantation in mice, and generated a BM-derived cell line (F2-7). Immunohistologic analyses demonstrated that parental and labeled BM-PDXs retained expression of critical clinical markers such as ER, progesterone receptor (PR), epidermal growth factor receptor (EGFR), HER2 and the basal cell marker cytokeratin 5 (CK5). Similarly, RNA sequencing analysis showed clustering of parental, labeled BM-PDXs and their corresponding cell line derivative. Intracardiac injection of dissociated cells from BM-E22-1, resulted in MRI-detectable macrometastases in 4/8 (50%) and micrometastases (8/8) (100%) mice, suggesting that BM-PDXs remain capable of colonizing the brain at high frequencies. Brain metastases developed 8 to 12 weeks after ic injection, located to the brain parenchyma, grew around blood vessels and elicited astroglia activation characteristic of breast cancer brain metastasis. These novel BM-PDXs represent heterogeneous and clinically relevant models to study mechanisms of brain metastatic colonization, with the added benefit of a slower progression rate that makes them suitable for preclinical testing of drugs in therapeutic settings.
2018-02-14 | GSE104020 | GEO
Project description:Purpose: There is an unmet clinical need for biomarkers to identify breast cancer patients who are at increased risk of developing brain metastases. The objective is to identify gene signatures and biological pathways associated with HER2+ brain metastasis. Experimental Design: Gene expression of 19 HER2+ breast cancer brain metastases was compared with HER2+ nonmetastatic primary tumors. Gene Set Enrichment Analysis was used to identify a signature, which was evaluated for correlation with BRCA1 mutation status and clinical outcome using published microarray datasets and for correlation with pharmacological inhibition by a PARP inhibitor and temozolomide using published microarray datasets of breast cancer cell lines. Results: A BRCA1 Deficient-Like (BD-L) gene signature is significantly correlated with HER2+ metastases in both our and an independent cohort. BD-L signature is enriched in BRCA1 mutation carrier primary tumors and HER2-/ER- sporadic tumors, but high values are found in a subset of ER+ and HER2+ tumors. Elevated BD-L signature in primary tumors is associated with increased risk of overall relapse, brain relapse, and decreased survival. The BD-L signature correlates with pharmacologic response to PARP inhibitor and temozolomide in two independent microarray datasets, and the signature outperformed four published gene signatures of BRCA1/2 deficiency. Conclusions: The BD-L signature is enriched in breast cancer brain metastases and identifies a subset of primary tumors with increased propensity for brain metastasis. Furthermore, this signature may serve as a biomarker to identify sporadic breast cancer patients who could benefit from a therapeutic combination of PARP inhibitor and temozolomide. Gene expression of 19 HER2+ human breast cancer brain metastases was compared with gene expression of 19 HER2+ nonmetastatic primary human breast tumors.
2014-04-24 | E-GEOD-43837 | biostudies-arrayexpress
Project description:DUSP6 inhibition overcomes Neuregulin/HER3-driven therapy resistance in HER2+ breast cancer [MDA]
| PRJNA966202 | ENA