Similar Datasets
Project description:Multi-contact 3C data reveal that the human genome is largely unentangled
| PRJNA612480 | ENA
Project description:During interphase, the eukaryotic genome is organized into chromosome territories that are spatially segregated into compartment domains. The extent to which interacting domains or chromosomes are entangled is not known. We analyze series of co-occurring chromatin interactions using multi-contact 3C (MC-3C) in human cells to provide insights into the topological entanglement of chromatin. Multi-contact interactions represent percolation paths (C-walks) through three-dimensional (3D) chromatin space. We find that the order of interactions within C-walks that occur across interfaces where chromosomes or compartment domains interact is not random. Polymer simulations show that such C-walks are consistent with distal domains being topologically insulated, that is, not catenated. Simulations show that even low levels of random strand passage, for example by topoisomerase II, would result in entanglements, increased mixing at domain interfaces and an order of interactions within C-walks not consistent with experimental MC-3C data. Our results indicate that, during interphase, entanglements between chromosomes and chromosomal domains are rare.
| S-EPMC7718335 | biostudies-literature
Project description:Salmonella sp. 3C strain:3C Genome sequencing
| PRJNA882226 | ENA
Project description:Scytalidium sp. 3C strain:3C Genome sequencing and assembly
| PRJNA243259 | ENA
Project description:Verrucomicrobium sp. 3C strain:3C Genome sequencing and assembly
| PRJNA165235 | ENA
Project description:Background: DNA in the nucleus of a living cell carries out its functions in the context of a complex, three-dimensional chromatin architecture. Several recently developed methods, each an extension of the chromatin conformation capture (3C) assay, have enabled the genome-wide profiling of chromatin contacts between pairs of loci in yeast, fruit fly, human and mouse. Especially in complex eukaryotes, data generated by these methods, coupled with other genome-wide datasets, demonstrated that non-random chromatin folding correlates strongly with cellular processes such as gene expression and DNA replication. Here we describe a novel assay to map genome-wide chromatin contacts, tethered multiple 3C (TM3C), that involves a simple protocol of restriction enzyme digestion and religation of fragments upon agarose gel beads followed by deep DNA paired-end sequencing. In addition to identifying contacts between pairs of loci, TM3C enables identification of contacts among more than two loci simultaneously. Results: We use TM3C to assay the genome architectures of two human cell lines: KBM7, a near-haploid chronic leukemia cell line, and NHEK, a normal diploid human epidermal keratinocyte cell line. We confirm that the contact frequency maps produced by TM3C exhibit features characteristic of existing genome architecture datasets, including the expected scaling of contact probabilities with genomic distance, as well as a low noise-to-signal ratio between inter- and intrachromosomal contacts. We also confirm that TM3C captures several known cell type-specific contacts, ploidy shifts and translocations, such as Ph+ formation in KBM7. Furthermore, we develop a two-phase mapping strategy that separately maps chimeric subsequences within a single read, allowing us to identify contacts involving three or four loci simultaneously, potentially corresponding to combinatorial regulation events. This mapping strategy also greatly increases the number of distinct binary contacts identified and, therefore, the coverage obtained for a fixed number of mapped reads. We confirm a subset of the triplet contacts involving the IGF2-H19 imprinting control region (ICR) using PCR analysis for KBM7 cells. Assaying the genome architecture of a near-haploid cell line allows us to create 3D models of a human cell line without averaging signal from two homologous copies of a chromosome. Our 3D models of KBM7 show clustering of small chromosomes with each other and large chromosomes with each other, consistent with previous studies of the genome architectures of other human cell lines. Conclusion: TM3C is a simple protocol for ascertaining genome architecture and can be used to identify simultaneous contacts among three or four loci. Application of TM3C to a near-haploid human cell line revealed large-scale features of chromosomal organization and complex chromatin loops that may play a role in regulating reciprocal expression of the IGF2 and H19 genes. Analysis of the spatial organization of two human cell lines (KBM7, a near-haploid chronic leukemia cell line, and NHEK, a normal diploid human epidermal keratinocyte cell line) using tethered multiple 3C (TM3C), a novel and simple protocol for ascertaining genome architecture which can be used to identify simultaneous contacts among three or four loci in addition to binary contacts that can be identified using traditional chromosome conformation capture coupled with next generation sequencing (Hi-C).
2015-04-29 | E-GEOD-60623 | biostudies-arrayexpress
Project description:Flavobacteria bacterium MS024-3C overview
| PRJNA36813 | ENA
Project description:Gordonibacter pamelaeae 3C RNA sequencing
| PRJNA557714 | ENA
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Comparsion of cellular gene expression between a control B lymphoma cell-line (BJAB pz2) stably transfected with an empty vector and a BJAB cell-line stably expressing Epstein-Barr virus EBNA 3C (BJAB E3C-4). These cell lines are described in Wang, F., C. Gregory, C. Sample, M. Rowe, D. Liebowitz, R. Murray, A. Rickinson, and E. Kieff. 1990. Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23. J Virol 64:2309-2318)
2012-03-13 | E-MEXP-3585 | biostudies-arrayexpress