Dataset Information

Long-read Nanopore sequencing of mouse neural stem cells

ABSTRACT: Purpose: The aim of this study is to identify genes that are under the transcriptional control of the epigenetic modifier Smchd1 in mouse neural stem cells. We profiled the transcriptomes of mouse neural stem cells from samples that were either wild-type or contained a null mutation in the epigenetic regulator Smchd1 using Oxford Nanopore Technologies (ONT) direct cDNA sequencing protocol and a PromethION sequencer.

ORGANISM(S): Mus musculus

PROVIDER: GSE151841 | GEO | 2020/06/18

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Purpose: Nanopore sequencing is a new generation of Nanopore-based single-molecule real-time electrical signal sequencing technology for full-length transcriptome sequencing. We use Oxford Nanopore Technology (ONT) three-generation full-length transcriptome sequencing to detect all genetic structural changes in the transcriptome of tumor endothelial cells (TECs) 2H-11 and normal endothelial cells (NECs) SVEC4-10. Methods: The mRNA profiles of three samples of mouse tumor endothelial cells (TECs) 2H-11 and three samples of mouse normal endothelial cells (NECs) were generated by Oxford Nanopore Technologies long read processing, using PromethION. Differential expression analysis of six samples was performed using the DESeq2 R package (1.6.3). Genes with a FDR < 0.01 and foldchange ≥ 2 found by DESeq2 were assigned as differentially expressed. Gene Ontology (GO) enrichment analysis of the differentially expressed genes (DEGs) was implemented by the GOseq R packages. KOBAS software was used to test the statistical enrichment of (DEGs) in KEGG pathways. Results: In mouse tumor endothelial cells 2H-11,1847 genes are up-regulated and 1202 genes are down-regulated. According to the Gene ontology (GO) enrichment analysis of differentially expressed genes (DEGs), we found that different functional trends related to metabolic processes, developmental processes, localization, immune system processes, and locomotion are the main reasons for the differences. DEGs are mainly enriched in signal pathways related to cancer, immunity and metabolism, involving Pathways in cancer, Antigen processing and presentation, Proteoglycans in cancer, Focal adhesion, MAPK signaling pathway, Protein digestion and absorption, ECM-receptor interaction, PI3K-Akt signaling pathway and Glutathione metabolism. We also obtained the structural variation of transcripts such as alternative splicing, gene fusion, and alternative polyadenylation and accurately quantified the expression of the transcript. Conclusions: Differentially expressed genes (DEGs) in key pathways may be potential diagnostic markers or therapeutic targets of TECs. Our study could help better understand the molecular mechanisms of tumor endothelial cells (TECs) involved in tumorigenesis and development. And our data also provide useful genetic resources for improving the genome and transcriptome annotations of TECs and normal endothelial cells (NECs).

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.

Dataset Information

Long-read Nanopore sequencing of mouse neural stem cells

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets