Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Lysine acetylation restricts mutant IDH2 activity to optimize transformation in AML cells

ABSTRACT: Mutant isocitrate dehydrogenase (IDH) 1 and 2 play a pathogenic role in cancers including acute myeloid leukemia (AML) by producing oncometabolite 2- hydroxyglutarate (2-HG) . We recently reported that tyrosine phosphorylation activates IDH1 R132H mutant in AML cells. Here we show that, surprisingly, mutant IDH2 (mIDH2) R140Q commonly has K413-acetylation, which negatively regulates mIDH2 activity in human AML cells by attenuating dimerization and blocking binding of substrate (α-ketoglutarate) and cofactor (NADPH). Mechanistically, K413-acetylation of mitochondrial mIDH2 is achieved through a series of hierarchical phosphorylation events mediated by tyrosine kinase FLT3, which phosphorylates mIDH2 to recruit upstream mitochondrial acetyltransferase ACAT1 and simultaneously activates ACAT1 and inhibits upstream mitochondrial deacetylase SIRT3 through tyrosine- phosphorylation. Moreover, we found that the intrinsic enzyme activity of mIDH2 is much higher than mIDH1, thus the inhibitory K413-acetylation optimizes leukemogenic ability of mIDH2 in AML cells by both producing sufficient 2-HG for transformation and avoiding cytotoxic accumulation of intracellular 2-HG.

ORGANISM(S): Homo sapiens

PROVIDER: GSE173531 | GEO | 2021/09/29

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

A personalized medicine approach identifies enasidenib as an efficient treatment for IDH2 mutant chondrosarcoma [MethArray_5days]

Project description:The heterogenous genomic nature of most sarcoma subtypes makes them especially indicated for personalized treatment approaches. Here, we developed a personalized medicine strategy based in the use of patient-derived cell lines as a drug-testing platform. Targeted sequencing of a panel of cancer-related genes in these models revealed the presence of IDH1 and IDH2 mutations in two chondrosarcomas. Mutant IDH (mIDH) enzymes produce the oncometabolite 2-HG which contributes to driving tumor growth. Thus, we treated several chondrosarcoma models with specific mIDH1/2 inhibitors. Among these treatments, only the mIDH2 inhibitor enasidenib was able to decrease 2-HG levels and to efficiently reduce the viability of mIDH2 chondrosarcoma cells. Importantly, oral administration of enasidenib in xenografted mice resulted in a complete abrogation of tumor growth. Enasidenib induced a profound remodeling of the transcriptomic landscape not associated to changes in the 5mC methylation levels and its anti-tumor effects were associated to the repression of proliferative pathways such as those controlled by E2F factors. Overall, this work provides the first preclinical evidence for the use of enasidenib to treat mIDH2 chondrosarcomas.

2024-03-12 | GSE261421 | GEO

A personalized medicine approach identifies enasidenib as an efficient treatment for IDH2 mutant chondrosarcoma [RNAseq_Enasidenib_L2975_SW1353]

2024-03-13 | GSE261434 | GEO

A personalized medicine approach identifies enasidenib as an efficient treatment for IDH2 mutant chondrosarcoma [MethArray_2days]

2024-03-11 | GSE235697 | GEO

A personalized medicine approach identifies enasidenib as an efficient treatment for IDH2 mutant chondrosarcoma [RNAseq_Enasidenib_T-CDS17#1]

2024-03-11 | GSE235605 | GEO

Blockade of ROS production inhibits oncogenic signaling in acute myeloid leukemia and amplifies response to precision therapies

Project description:Mutations in the type III receptor tyrosine kinase FLT3 are frequent in patients with acute myeloid leukemia (AML) and are associated with a poor prognosis. AML is characterized by the overproduction of reactive oxygen species (ROS), which can induce cysteine oxidation in redox-sensitive signaling proteins. Here, we sought to characterize the specific pathways affected by ROS in AML by assessing oncogenic signaling in primary AML samples. The oxidation or phosphorylation of signaling proteins that mediate growth and proliferation was increased in samples from patient subtypes with FLT3 mutations. These samples also showed increases in the oxidation of proteins in the ROS-producing Rac/NADPH oxidase-2 (NOX2) complex. Inhibition of NOX2 increased the apoptosis of FLT3-mutant AML cells in response to FLT3 inhibitors. NOX2 inhibition also reduced the phosphorylation and cysteine oxidation of FLT3 in patient-derived xenograft mouse models, suggesting that decreased oxidative stress reduces the oncogenic signaling of FLT3. In mice grafted with FLT3 mutant AML cells, treatment with a NOX2 inhibitor reduced the number of circulating cancer cells, and combining FLT3 and NOX2 inhibitors increased survival to a greater extent than either treatment alone. Together, these data raise the possibility that combining NOX2 and FLT3 inhibitors could improve the treatment of FLT3 mutant AML.

2023-05-03 | PXD032104 | Pride

Autophagy inhibition impairs leukemia stem cell function in FLT3-ITD AML but has antagonistic interactions with tyrosine kinase inhibition

Project description:The FLT3-ITD mutation is associated with poor prognosis in acute myeloid leukemia (AML). FLT3 tyrosine kinase inhibitors (TKIs) demonstrate clinical efficacy but fail to target leukemia stem cells (LSC) and do not generate sustained responses. Autophagy is an important cellular stress response contributing to hematopoietic stem cells (HSC) maintenance and promoting leukemia development. Here we investigated the role of autophagy in regulating FLT3-ITD AML stem cell function and response to TKI treatment. We show that autophagy inhibition reduced quiescence and depleted repopulating potential of FLT3-ITD AML LSC, associated with mitochondrial accumulation and increased oxidative phosphorylation. However, TKI treatment reduced mitochondrial respiration and unexpectedly antagonized the effects of autophagy inhibition on LSC attrition. We further show that TKI-mediated targeting of AML LSC and committed progenitors was p53-dependent, and that autophagy inhibition enhanced p53 activity and increased TKI-mediated targeting of AML progenitors, but decreased p53 activity in LSC and reduced TKI-mediated LSC inhibition. These results provide new insights into the role of autophagy in differentially regulating AML stem and progenitor cells, reveal unexpected antagonistic effects of combined oncogenic tyrosine kinase inhibition and autophagy inhibition in AML LSC, and suggest an alternative approach to target AML LSC quiescence and regenerative potential.

2022-10-13 | GSE169750 | GEO

Synergistic targeting of DNA-PK and KIT signaling pathways in KIT mutant acute myeloid leukemia

Project description:Acute Myeloid Leukemia (AML) is the most common and aggressive form of acute leukemia, with a 5-year survival rate of just 24%. Over a third of all AML patients harbor activating mutations in kinases, such as the receptor tyrosine kinases FLT3 and KIT. FLT3 and KIT mutations are associated with poor clinical outcomes and lower remission rates in response to standard-of-care chemotherapy. We have recently identified that the core kinase of the non-homologous end joining DNA repair pathway, DNA-PK, is activated downstream of FLT3; and targeting DNA-PK sensitized FLT3-mutant AML cells to standard-of-care therapies. Herein, we investigated DNA-PK as a possible therapeutic vulnerability in KIT mutant AML, using isogenic FDC-P1 myeloid progenitor cell lines transduced with an empty vector or oncogenic mutant KIT (V560G, D816V). Targeted quantitative phosphoproteomic profiling identified phosphorylation of DNA-PK at threonine 2599 in KIT mutant cells, indicative of DNA-PK activation. Accordingly, proliferation assays revealed that KIT mutant FDC-P1 cells were more sensitive to the DNA-PK inhibitors M3814 or NU7441, compared to empty vector controls. DNA-PK inhibition combined with inhibition of KIT signaling via using the kinase inhibitors dasatinib or ibrutinib, or the protein phosphatase 2A activators FTY720 or AAL(S), led to synergistic cell death. Discovery phosphoproteomic analysis of KIT-D816V cells revealed that dasatinib single-agent treatment inhibited ERK1 activity, and M3814 single-agent treatment inhibited Akt/mTOR activity. The combination of dasatinib and M3814 treatment inhibited both ERK/MAPK and Akt/mTOR activity, and induced synergistic inhibition of phosphorylation of transcription regulators including MYC and MYB. This study provides insight into the oncogenic pathways regulated by DNA-PK beyond its canonical role in DNA repair, and demonstrates that DNA-PK is a promising novel therapeutic target for KIT mutant cancers.

2023-01-26 | PXD030214 | panorama

Mitochondrial carrier homolog 2 (MTCH2) is necessary for AML survival

Project description:Through a CRISPR screen to identify mitochondrial genes necessary for the growth of AML cells, we identified the mitochondrial outer membrane protein MTCH2 (Mitochondrial Carrier Homolog 2). In AML, knockdown of MTCH2 decreased growth, reduced engraftment potential of stem cells and induced differentiation. Inhibiting MTCH2 altered in AML cells increased nuclear pyruvate and pyruvate dehydrogenase that induced histone acetylation and subsequently promoted the differentiation of AML cells. Thus, we have defined a new mechanism by which mitochondria and metabolism regulate AML stem cells and gene expression.

2020-03-25 | GSE147508 | GEO

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Phosphoproteomic profiling of D816V-KIT cells

Project description:Acute Myeloid Leukaemia (AML) carries a 5 year survival rate of just 24%. Toxic chemotherapy regimens remain the backbone of standard of care for AML. The KIT tyrosine kinase is a recognised AML oncogene, associated with poor outcome. We recently identified DNA-PK as a novel therapeutic target in FLT3 mutant AML. The similarity between KIT and FLT3 regulated signalling pathways led us to investigate DNA-PK in KIT-mutant AML.

2023-01-26 | PXD030005 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data