Dataset Information

RNA sequencing of AHNAK2 knockdown adenocarcinoma cells compared with the scramble controls

ABSTRACT: We knockdown-expressed the AHNAK2 in Hela cells, MDA-MB-231 cells and HCT116 cells using the lentiviral construct Plko.1. Then using RNA-sequencing (Illumina) to compare AHNAK2 knockdown cells to the scramble controls.

ORGANISM(S): Homo sapiens

PROVIDER: GSE179982 | GEO | 2021/07/16

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Project description:Fanconi anemia (FA) is a genetic disorder characterized by congenital abnormalities, bone marrow failure and increased susceptibility to cancer. Of the fifteen FA proteins, Fanconi anemia group C (FANCC) is one of eight FA core complex components of the FA pathway. Unlike other FA core complex proteins, FANCC is mainly localized in the cytoplasm, where it is thought to function in apoptosis, redox regulation, cytokine signaling and other processes. Previously, we showed that regulation of FANCC involved proteolytic processing during apoptosis. To elucidate the biological significance of this proteolytic modification, we searched for molecular interacting partners of proteolytic FANCC fragments. Among the candidates obtained, the transcriptional corepressor protein C-terminal binding protein-1 (CtBP1) interacted directly with FANCC and other FA core complex proteins. Although not required for stability of the FA core complex or ubiquitin ligase activity, CtBP1 is essential for proliferation, cell survival and maintenance of chromosomal integrity. Expression profiling of CtBP1-depleted and FA-depleted cells revealed that several genes were commonly up- and down-regulated, including the Wnt antagonist Dickkopf-1 (DKK1). These findings suggest that FA and Wnt signaling via CtBP1 could share common effectors. HeLa cell line was grown in DMEM media supplemented with 10% FBS and were incubated in 5% CO2 at 37Â°C. A four-plasmid (pRSV-Rev, pMDLg/pRRE, pMD2.G and pLKO.1) expression system was used for lentiviral production. Different pLKO.1 plasmids carrying shRNAs targeting FANCA, FANCD2, CtBP1 or CtBP2 or a lentiviral control vector pLKO.1-scrambled were used. Lentiviral particles were produced via calcium phosphate-mediated transient transfection of the four plasmids into HEK293T cells. Cells were exposed to appropriate lentiviral particles. In each experiment, HeLa cells were transduced for 6 hours with filtered supernatant containing recombinant lentiviral particles. After transduction, the cells were cultured for 72 hours. Total RNA extracts from 3 different samples of each scrambled, CtBPs and FANCD2 shRNA treated HeLa cells were subjected to gene expression profiling via microarray analysis. Gene expression profiles were determined with Affymetrix GeneChipÂ® Human Gene 1.0.

Dataset Information

RNA sequencing of AHNAK2 knockdown adenocarcinoma cells compared with the scramble controls

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets