Dataset Information

Selective recruitment of the AAA+ ATPase TnsC increases the fidelity of Type I-F CRISPR RNA-guided transposition

ABSTRACT: Bacterial transposons are pervasive mobile genetic elements that exploit distinct DNA binding proteins for their horizontal spread. For example, E. coli Tn7 homes to a specific attachment site using a TniQ family protein, whereas diverse Tn7-like transposons employ Type I or Type V CRISPR-Cas systems to insert downstream of target sites specified by a guide RNA. Despite this targeting pathway diversity, transposition invariably requires TnsB, a DDE superfamily transposase that catalyses DNA excision and insertion, and TnsC, a AAA+ ATPase that is thought to communicate between the transposase and targeting proteins. How TnsC mediates this communication and thereby regulates transposition fidelity has remained elusive. Here we apply chromatin immunoprecipitation sequencing (ChIP-seq) to monitor in vivo formation of the Vibrio cholerae RNA-guided transpososome, allowing us to unambiguously resolve distinct protein recruitment events prior to integration. DNA targeting by the TniQ-Cascade complex is surprisingly promiscuous, leading to binding at hundreds of genomic off-target sites, but only a subset of those sites are licensed for TnsC and TnsB recruitment, revealing a crucial proofreading checkpoint that controls transposition fidelity. To advance the mechanistic understanding of interactions responsible for transpososome assembly, we analysed V. cholerae TnsC by cryo-EM and found that TnsC forms ATP-dependent heptameric rings, which are likely to play a critical architectural role in positioning DNA substrates for downstream integration. Collectively, our results highlight the molecular specificity imparted by consecutive binding of distinct factors to genomic target sites during RNA-guided transposition, and provide a structural roadmap to guide future engineering efforts.

ORGANISM(S): Escherichia coli

PROVIDER: GSE183114 | GEO | 2021/10/31

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Insertion sequences (IS) are compact and pervasive transposable elements found in bacteria, which encode only the genes necessary for their mobilization and maintenance. IS200/IS605 elements undergo ‘peel-and-paste’ transposition catalyzed by a TnpA transposase, but intriguingly, they also encode diverse, TnpB-family genes that are evolutionarily related to the CRISPR-associated effectors Cas9 and Cas12. Recent studies demonstrated that TnpB-family enzymes function as RNA-guided DNA endonucleases, but the broader biological role of this activity has remained enigmatic. Here we show that IscB and TnpB are essential to prevent loss of the donor IS element and potential transposon extinction as a consequence of the TnpA transposition mechanism. We first performed phylogenetic analysis of IscB/TnpB proteins and selected a family of related IS elements from Geobacillus stearothermophilus that we predicted would be mobilized by a common TnpA homolog. After reconstituting transposition using a heterologous expression system in E. coli, we found that IS elements were readily lost from the donor site due to the activity of TnpA in rejoining the flanking sequences back together upon excision. However, these IS elements also encode non-coding RNAs that guide TnpB and IscB nucleases to precisely recognize and cleave these excision products, leading either to elimination of the excision product or re-installation of the transposon through recombination. Indeed, under experimental conditions in which TnpA and TnpB-RNA complexes were co-expressed together with a genomically integrated IS element, transposon retention was significantly increased relative to conditions expressing TnpA alone. Remarkably, both TnpA and TnpB recognize the same AT-rich transposon-adjacent motif (TAM) during transposon excision and RNA-guided DNA cleavage, respectively, revealing a striking convergence in the evolution of DNA sequence specificity between transposase and nuclease. Collectively, our study reveals that RNA-guided DNA cleavage is a primal biochemical activity that arose to bias the selfish inheritance of transposable elements, which was later co-opted during the evolution of CRISPR-Cas adaptive immunity for antiviral defense.

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Selective recruitment of the AAA+ ATPase TnsC increases the fidelity of Type I-F CRISPR RNA-guided transposition

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure