Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).

ABSTRACT: Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.

ORGANISM(S): Homo sapiens

PROVIDER: GSE190507 | GEO | 2022/04/06

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

APEX-seq performed for DDX3X and DDX3Y without arsenite treatment

Project description:Sex differences are pervasive in human health and disease. One of the major keys to sex-biased differences lies in the sex chromosomes, which encode a group of sex-specific protein homologs. Although the functions of the X chromosome proteins are well appreciated, how they compare with their Y chromosome homologs remains elusive. One pair of sex chromosome-encoded proteins are the RNA helicases DDX3X and DDX3Y. DDX3X and DDX3Y can both form stress granules (SGs) under different types of stress. SGs are composed of a stable core structure, they are surrounded by a dynamic shell with assembly, disassembly, and transitions of proteins and RNA between the core and shell. Different SGs have distinct proteins and RNA constituents, which raises the possibility that different SGs might perform different biological functions. Previously, we performed APEX-seq to explore the RNA compositions in DDX3X and DDX3Y SGs, however, the difference between the mRNA partner of DDX3X and DDX3Y without stress treatment is still uncharted. Therefore, we applied the APEX-seq to cytosome diffused DDX3X and DDX3Y.

2022-06-01 | GSE193783 | GEO

APEX-seq Captures the Protein-RNA Interaction Patterns of DDX3X and DDX3Y

Project description:Although stress granules (SGs) are composed of a stable core structure, they are surrounded by a dynamic shell with assembly, disassembly, and transitions of proteins and RNA between the core and shell. Different SGs have distinct proteins and RNA constituents, which raises the possibility that different SGs might perform different biological functions. The RNA compositions of DDX3X- or DDX3Y-positive SGs are not known, nor is it known what differential effects DDX3X or DDX3Y may exert on these RNA components. To understand the biological function and the compositional differences between DDX3X- or DDX3Y-positive SGs, we first determined the RNA constituents in these SGs using an adapted Ascorbate-peroxidase (APEX)-based proximity labeling method. APEX converts exogenously supplied biotin-phenol (BP) to biotin-phenoxyl radicals, which in turn covalently labels protein and RNA in nanometers. APEX-mediated biotinylation has been widely used in studies of protein-protein interactions and recently in studying protein-RNA interactions. Here, we applied the APEX-mediated biotinylation in DDX3X and DDX3Y SGs to dissect their different RNA composition.

2022-06-01 | GSE171792 | GEO

Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).

Project description:Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).

| PRJNA787308 | ENA

Sexually dimorphic RNA helicases DDX3X and DDX3Y differentially regulate hollow condensates of DDX3X disease variants

Project description:The sex chromosome-encoded RNA helicases DDX3X and DDX3Y play important roles in RNA metabolism. Heterozygous mutations of DDX3X frequently occur in cancers and neurodevelopmental disorders which have strong sex biases. However, how different DDX3X variants impair cellular function in sex specific genetic background is not understood. Herein, we found that DDX3X variants with significantly impaired ATPase activities demixed into the shells of unique hollow condensates, the dynamics of which were further differentiated by the RNA binding affinities of the different DDX3X variants. Proteomic and imaging studies revealed that DDX3X variant condensates sequestered wild-type DDX3X, DDX3Y, and other proteins important for various signaling pathways. Intriguingly, wild-type DDX3X improved the dynamics of heterogenous variant/wild-type hollow condensates more than DDX3Y. These results suggest that DDX3X variants with distinct enzymatic and condensation propensities may interact uniquely with wild-type DDX3X or DDX3Y to cause sex-specific cellular impacts.

2022-11-26 | MSV000090789 | MassIVE

Male-specific lymphomagenesis by serial inverse dysregulation of the RNA helicases DDX3X and DDX3Y.

Project description:DDX3X is a ubiquitously expressed RNA helicase involved in multiple stages of RNA biogenesis. DDX3X is frequently mutated in Burkitt lymphoma but the functional basis for this is unknown. Here, we show that loss-of-function DDX3X mutations are also commonly found in MYC-translocated diffuse large B cell lymphoma and reveal functional co-operation between mutant DDX3X and MYC. We show that DDX3X promotes translation of mRNAs encoding components of the core translational machinery, thereby driving global protein synthesis. Loss-of-function DDX3X mutations moderate MYC-driven global protein synthesis, thereby buffering MYC-induced proteotoxic stress during early lymphomagenesis. Established lymphoma cells subsequently restore full protein synthetic capacity by ectopic expression of DDX3Y, a Y-chromosome homologue that is normally expressed exclusively in testis. These findings highlight the vulnerability of MYC-driven lymphoma to proteotoxic stress and identify an unexpected male-specific mechanism of carcinogenesis, namely the commandeering of a testis-specific Y-chromosome gene to drive full malignant transformation.

2021-09-01 | GSE143393 | GEO

Male-specific lymphomagenesis by serial inverse dysregulation of the RNA helicases DDX3X and DDX3Y [Cell Line Clones]

2021-09-01 | GSE144983 | GEO

APEX-seq performed for DDX3X and DDX3Y without arsenite treatment

Project description:APEX-seq performed for DDX3X and DDX3Y without arsenite treatment

| PRJNA797960 | ENA

APEX-seq Captures the Protein-RNA Interaction Patterns of DDX3X and DDX3Y

Project description:APEX-seq Captures the Protein-RNA Interaction Patterns of DDX3X and DDX3Y

| PRJNA720922 | ENA

Male-specific lymphomagenesis by serial inverse dysregulation of the RNA helicases DDX3X and DDX3Y.

Project description:Male-specific lymphomagenesis by serial inverse dysregulation of the RNA helicases DDX3X and DDX3Y.

| PRJNA605444 | ENA

DDX3X and DDX3Y are redundant in protein synthesis.

Project description:DDX3 is a DEAD-box RNA helicase that regulates translation and is encoded by the X- and Y-linked paralogs DDX3X and DDX3Y While DDX3X is ubiquitously expressed in human tissues and essential for viability, DDX3Y is male-specific and shows lower and more variable expression than DDX3X in somatic tissues. Heterozygous genetic lesions in DDX3X mediate a class of developmental disorders called DDX3X syndrome, while loss of DDX3Y is implicated in male infertility. One possible explanation for female-bias in DDX3X syndrome is that DDX3Y encodes a polypeptide with different biochemical activity. In this study, we use ribosome profiling and in vitro translation to demonstrate that the X- and Y-linked paralogs of DDX3 play functionally redundant roles in translation. We find that transcripts that are sensitive to DDX3X depletion or mutation are rescued by complementation with DDX3Y. Our data indicate that DDX3X and DDX3Y proteins can functionally complement each other in the context of mRNA translation in human cells. DDX3Y is not expressed in a large fraction of the central nervous system. These findings suggest that expression differences, not differences in paralog-dependent protein synthesis, underlie the sex-bias of DDX3X-associated diseases.

| S-EPMC8594478 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data