Searching for new molecules involved in Anopheles mosquitoes’ response to Plasmodium infection
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles stephensi
PROVIDER: GSE197159 | GEO | 2024/05/06
REPOSITORIES: GEO
Similar Datasets
Project description:Transmission of malaria is dependent on the successful completion of the Plasmodium lifecycle in the Anopheles vector. Major obstacles are encountered in the midgut tissue, where most parasites are killed by the mosquito’s immune system. In the present study, DNA microarray analyses have been used to compare Anopheles gambiae responses to invasion of the midgut epithelium by the ookinete stage of the human pathogen Plasmodium falciparum and the rodent experimental model pathogen P. berghei. Invasion by P. berghei had a more profound impact on the mosquito transcriptome, including a variety of functional gene classes, while P. falciparum elicited a broader immune response at the gene transcript level. Ingestion of human malaria-infected blood lacking invasive ookinetes also induced a variety of immune genes, including several anti-Plasmodium factors. By comparing gene expression patterns between carcassess or guts of mosquitoes that fed on a P. falciparum or P. berghei wt and mosquitoes that fed on invasion incapable strains we gain information on the A. gambiae transcriptional responses to the invading ookinete at 24 hours after feeding. By comparing gene expression patterns between carcassess or guts of mosquitoes that fed on a P. falciparum ookinete invasion incapable strain and mosquitoes that fed on non-infected blood we gain information on the A. gambiae transcriptional responses to malaria infected blood in absence of ookinete invasion at 24 hours after feeding. By comparing gene expression patterns between mosquitoes at 4 hours after being injected with either E. coli or S. aureus and mosquitoes injected with sterile PBS we gain information on the mosquito's transcriptional response to these bacterial challenges.
2007-08-15 | E-GEOD-8789 | biostudies-arrayexpress
Project description:Malaria is caused by Plasmodium parasites, which are transmitted via the bites of infected Anopheline mosquitoes. Midgut invasion is a major bottleneck for Plasmodium development inside the mosquito vectors as a rapidly responding immune system recognizes ookinetes and recruits killing factors from the midgut and surrounding tissues, dramatically reducing the population of invading ookinetes before they can successfully traverse the midgut epithelium. Understanding molecular details of the parasite-vector interactions requires precise measurement of nascent protein synthesis in the mosquito during Plasmodium infection. Current expression profiling primarily monitors alterations in steady-state levels of mRNA, but does not address the equally critical issue of whether the proteins encoded by the mRNAs are actually synthesized. In this study, we used sucrose density gradient centrifugation to isolate actively translating Anopheles gambiae mRNAs based upon their association with polyribosomes (polysomes). The proportion of individual gene transcripts associated with polysomes, which is determined by RNA deep sequencing, reflects mRNA translational status. This approach led to identification of 1017 mosquito transcripts that were primarily regulated at the translational level after ingestion of Plasmodium falciparum-infected blood. Caspar, a negative regulator of the NF-kappaB transcription factor Rel2, appears to be substantially activated at the translational levels during Plasmodium infection. In addition, transcripts of Dcr1, Dcr2 and Drosha, which are involved in small RNA biosynthesis, exhibited enhanced associations with polysomes after P. falciparum challenge. This observation suggests that mosquito microRNAs may play an important role in reactions against Plasmodium invasion. We analyzed both total cellular mRNAs and mRNAs that are associated with polysomes to simultaneously monitor transcriptomes and nascent protein synthesis in the mosquito. This approach provides more accurate information regarding the rate of protein synthesis, and identifies some mosquito factors that might have gone unrecognized because expression of these proteins is regulated mainly at the translational level rather than at the transcriptional level after mosquitoes ingest a Plasmodium-infected blood meal.
2012-09-21 | GSE38707 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Transmission of malaria is dependent on the successful completion of the Plasmodium lifecycle in the Anopheles vector. Major obstacles are encountered in the midgut tissue, where most parasites are killed by the mosquito’s immune system. In the present study, DNA microarray analyses have been used to compare Anopheles gambiae responses to invasion of the midgut epithelium by the ookinete stage of the human pathogen Plasmodium falciparum and the rodent experimental model pathogen P. berghei. Invasion by P. berghei had a more profound impact on the mosquito transcriptome, including a variety of functional gene classes, while P. falciparum elicited a broader immune response at the gene transcript level. Ingestion of human malaria-infected blood lacking invasive ookinetes also induced a variety of immune genes, including several anti-Plasmodium factors. Keywords: Anopheles gambiae, Plasmodium falciparum, ookinete, invasion, innate immunity
2007-08-15 | GSE8789 | GEO
Project description:Malaria is caused by Plasmodium parasites, which are transmitted via the bites of infected Anopheline mosquitoes. Midgut invasion is a major bottleneck for Plasmodium development inside the mosquito vectors as a rapidly responding immune system recognizes ookinetes and recruits killing factors from the midgut and surrounding tissues, dramatically reducing the population of invading ookinetes before they can successfully traverse the midgut epithelium. Understanding molecular details of the parasite-vector interactions requires precise measurement of nascent protein synthesis in the mosquito during Plasmodium infection. Current expression profiling primarily monitors alterations in steady-state levels of mRNA, but does not address the equally critical issue of whether the proteins encoded by the mRNAs are actually synthesized. In this study, we used sucrose density gradient centrifugation to isolate actively translating Anopheles gambiae mRNAs based upon their association with polyribosomes (polysomes). The proportion of individual gene transcripts associated with polysomes, which is determined by RNA deep sequencing, reflects mRNA translational status. This approach led to identification of 1017 mosquito transcripts that were primarily regulated at the translational level after ingestion of Plasmodium falciparum-infected blood. Caspar, a negative regulator of the NF-kappaB transcription factor Rel2, appears to be substantially activated at the translational levels during Plasmodium infection. In addition, transcripts of Dcr1, Dcr2 and Drosha, which are involved in small RNA biosynthesis, exhibited enhanced associations with polysomes after P. falciparum challenge. This observation suggests that mosquito microRNAs may play an important role in reactions against Plasmodium invasion. We analyzed both total cellular mRNAs and mRNAs that are associated with polysomes to simultaneously monitor transcriptomes and nascent protein synthesis in the mosquito. This approach provides more accurate information regarding the rate of protein synthesis, and identifies some mosquito factors that might have gone unrecognized because expression of these proteins is regulated mainly at the translational level rather than at the transcriptional level after mosquitoes ingest a Plasmodium-infected blood meal. Midguts from female Anopheles gambiae mosquitoes were dissected at around 24 h after ingestion of P. falciparum-infected blood. Mosquitoes fed on uninfected blood were used as control. A portion of the midguts were used for isolation of total cellular RNA. Extracts of the remaining midguts were fractionated over sucrose density gradients, and fifteen fractions were collected from the top of each gradient. Non-polysomal fractions, as well as polysomal fractions were combined, respectively, to obtain two RNA pools per gradient for three independent experiments. The first, last and the sample between non-polysomal and polysomal, were all discarded to ensure pure pools from each set. A fourth experiment was conducted where the polysomal and non-polysomal samples were not pooled, to be used later for qRT-PCR. The mRNA levels of individual mosquito genes in polysome (PS) fractions, nonpolysome (NP) fractions and unfractionated steady-state (total) RNA were determined using high throughput RNA deep sequencing. Each RNA pool generated 2.1-9.8 million raw read . Signal intensities of transcripts from each PS pool were compared to those of transcripts from a matching NP pool. To quantify the translational status of individual mRNA species, we define the relative PS loading [PL=P/(P+NP)] as the extent of mRNA association with polysomes. PL values were compared between the mosquitoes fed on P. falciparum-infected or -uninfected blood.
2012-09-21 | E-GEOD-38707 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Plasmodium sporozoites are injected, in addition to saliva, into animal hosts when a female Anopheles mosquito takes a blood meal. The molecular components of saliva that interact with Plasmodium during this process are poorly characterized. Here we collected Plasmodium sporozoites directly from salivating Anopheles mosquitoes and looked for the presence of vector proteins that could be interacting with the parasites during transmission for further characterization.
2018-10-18 | PXD010121 | Pride
Project description:Colonization of the mosquito host by Plasmodium parasites is achieved by sexually differentiated gametocytes. Gametocytogenesis, gamete formation and fertilization are tightly regulated processes, and translational repression is a major regulatory mechanism for stage conversion. Here, we present a characterization of a Plasmodium berghei RNA binding protein, UIS12, that contains two conserved eukaryotic RNA recognition motifs (RRM). Targeted gene deletion results in viable parasites that replicate normally during blood infection, but form fewer gametocytes. Upon transmission to Anopheles stephensi mosquitoes, both numbers and size of midgut-associated oocysts are impaired. As a consequence, no salivary gland sporozoites are formed indicative of a complete life cycle arrest in the mosquito vector. Comparative transcript profiling in mutant and wild-type infected red blood cells revealed downregulation of mRNAs coding for signature gamete-, ookinete- and oocyst-specific proteins in uis12(-) parasites. Together, our findings indicate multiple roles for UIS12 in regulation of gene expression after blood infection in good agreement with the pleiotropic defects that terminate successful sporogony and onward transmission to a new vertebrate host.
2021-03-05 | GSE152686 | GEO
Project description:The mosquito Anopheles gambiae uses its innate immune system to control bacterial and Plasmodium infection of its midgut tissue. The activation of potent IMD pathway-mediated anti-Plasmodium falciparum defenses is dependent on the presence of the midgut microbiota, which activate this defense system upon parasite infection through a peptidoglycan recognition protein, PGRPLC. We employed transcriptomic and reverse genetic analyses to compare the P. falciparum infection-responsive transcriptomes of septic and aseptic mosquitoes and to determine whether bacteria-independent anti-Plasmodium defenses exist. To examine the impact of P. falciparum infection on the mosquito midgut and carcass transcriptomes in the presence or absence of midgut bacteria, we used A. gambiae whole genome microarrays to compare the mRNA abundance of P. falciparum-infected and -naïve mosquitoes of antibiotic- and non-antibiotic treated cohorts. P. falciparum infection induced changes in the abundance of as many as 2,183 and 2,429 transcripts in whole mosquitoes belonging to a variety of functional groups in aseptic and septic mosquitoes. Ultimately, we were interested in identifying the genes involved in bacteria-independent anti-Plasmodium responses, and therefore we focused on transcripts displaying increased abundance in the parasite-infected aseptic midguts, placing a particular emphasis on those with predicted immune functions. Because of the central role of serine protease cascades in regulating insect immune defenses, we focused the remainder of our analysis on a clip-domain serine protease C2 (CLIPC2, AGAP004317) and a serine protease inhibitor 7 (SRPN7, AGAP007693) that were specifically upregulated in the parasite-infected, aseptic mosquito midgut. We showed that SRPN7 negatively and CLIPC2 positively regulate the anti-Plasmodium defense, independently of the midgut-associated bacteria. Co-silencing assays suggested that these two genes may function together in a signaling cascade. Neither gene was regulated, nor modulated, by infection with the rodent malaria parasite Plasmodium berghei, suggesting that SRPN7 and CLIPC2 are components of a defense system with preferential activity towards P. falciparum. Further analysis using RNA interference determined that these genes do not regulate the anti-Plasmodium defense mediated by the IMD pathway, and both factors act as agonists of the endogenous midgut microbiota, further demonstrating the lack of functional relatedness between these genes and the bacteria-dependent activation of the IMD pathway. This is the first study confirming the existence of a bacteria-independent, anti-P. falciparum defense. Aseptic and septic midguts and carcasses from P. falciparum-infected A. gambiae vs aseptic and septic midguts and carcasses from uninfected, blood-fed A. gambiae. 3 biological replicates and 1 pseudo-replicate per each array.
2013-08-10 | E-GEOD-49690 | biostudies-arrayexpress
Project description:The mosquito Anopheles gambiae uses its innate immune system to control bacterial and Plasmodium infection of its midgut tissue. The activation of potent IMD pathway-mediated anti-Plasmodium falciparum defenses is dependent on the presence of the midgut microbiota, which activate this defense system upon parasite infection through a peptidoglycan recognition protein, PGRPLC. We employed transcriptomic and reverse genetic analyses to compare the P. falciparum infection-responsive transcriptomes of septic and aseptic mosquitoes and to determine whether bacteria-independent anti-Plasmodium defenses exist. To examine the impact of P. falciparum infection on the mosquito midgut and carcass transcriptomes in the presence or absence of midgut bacteria, we used A. gambiae whole genome microarrays to compare the mRNA abundance of P. falciparum-infected and -naïve mosquitoes of antibiotic- and non-antibiotic treated cohorts. P. falciparum infection induced changes in the abundance of as many as 2,183 and 2,429 transcripts in whole mosquitoes belonging to a variety of functional groups in aseptic and septic mosquitoes. Ultimately, we were interested in identifying the genes involved in bacteria-independent anti-Plasmodium responses, and therefore we focused on transcripts displaying increased abundance in the parasite-infected aseptic midguts, placing a particular emphasis on those with predicted immune functions. Because of the central role of serine protease cascades in regulating insect immune defenses, we focused the remainder of our analysis on a clip-domain serine protease C2 (CLIPC2, AGAP004317) and a serine protease inhibitor 7 (SRPN7, AGAP007693) that were specifically upregulated in the parasite-infected, aseptic mosquito midgut. We showed that SRPN7 negatively and CLIPC2 positively regulate the anti-Plasmodium defense, independently of the midgut-associated bacteria. Co-silencing assays suggested that these two genes may function together in a signaling cascade. Neither gene was regulated, nor modulated, by infection with the rodent malaria parasite Plasmodium berghei, suggesting that SRPN7 and CLIPC2 are components of a defense system with preferential activity towards P. falciparum. Further analysis using RNA interference determined that these genes do not regulate the anti-Plasmodium defense mediated by the IMD pathway, and both factors act as agonists of the endogenous midgut microbiota, further demonstrating the lack of functional relatedness between these genes and the bacteria-dependent activation of the IMD pathway. This is the first study confirming the existence of a bacteria-independent, anti-P. falciparum defense.
2013-08-10 | GSE49690 | GEO