Transcriptome analysis of tomato seedlings infected by Pepino Mosaic Virus
Ontology highlight
ABSTRACT:
ORGANISM(S): Solanum lycopersicum
PROVIDER: GSE203627 | GEO | 2022/05/24
REPOSITORIES: GEO
Similar Datasets
Project description:The gram- positive bacterial pathogen Clavibacter michiganensis subsp. michiganensis (Cmm) causes huge economic losses by infecting tomato plants worldwide. Cmm can be spread by contaminated seeds and transplants, penetrating the plant through natural openings or wounds and is transferred through the plant xylem. While in recent years significant progress has been made to elucidate plant responses to pathogenic gram-negative bacteria by gene expression studies, the molecular mechanisms that lead to disease symptoms caused by gram-positive bacteria like Cmm remain elusive. An indigenous virulent Cmm strain isolated from a farm crop of Pomodoro tomatoes in southern Greece was used for the infection of EKSTASIS F1 hybrid tomato seedlings. Here, we present the results of a deep RNA- sequencing (RNA-seq) analysis performed to characterize the dynamic expression profile of tomato genes upon Cmm infection.
2021-08-10 | GSE160971 | GEO
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:Background: Honey bee is a major insect used for pollination of a number of commercial crops worldwide. However, the number of managed honey bee colonies has recently declined in several countries, and a number of possible causes are proposed. Although the use of honey bees for pollination can be considered as disruption of the habitat, its effects on honey bees' physiology have never been addressed. In Japan, more than 100 thousands colonies are annually used for pollination, and intriguingly 80% of them are used in greenhouses. Recently, honey bee colonies have often collapsed when they are introduced into greenhouses. Thus, to suppress colony collapses and maintain the number of worker bees in the colonies are essential for successful long-term pollination in greenhouses and recycling honey bee colonies. Honey bee hives were installed into strawberry and eggplant greenhouses, and then the gene expression profiles of the honey bees were examined at the different time periods. Total 16 samples with two replicates were analyzed.
2011-05-12 | E-GEOD-29252 | biostudies-arrayexpress
Project description:Background: Honey bee is a major insect used for pollination of a number of commercial crops worldwide. However, the number of managed honey bee colonies has recently declined in several countries, and a number of possible causes are proposed. Although the use of honey bees for pollination can be considered as disruption of the habitat, its effects on honey bees' physiology have never been addressed. In Japan, more than 100 thousands colonies are annually used for pollination, and intriguingly 80% of them are used in greenhouses. Recently, honey bee colonies have often collapsed when they are introduced into greenhouses. Thus, to suppress colony collapses and maintain the number of worker bees in the colonies are essential for successful long-term pollination in greenhouses and recycling honey bee colonies.
2011-05-12 | GSE29252 | GEO
Project description:The aim of this study was to compare the tomato global transcriptional profiles in response to host attack by ToMV and Fol in order to identify genomic differences and similarities in incompatible interactions between a foliar and a vascular pathogen. In order to identify a set of genes of interest in tomato plants infected with F. oxysporum f. sp. lycopersici (Fol) and Tomato Mosaic Virus (ToMV) a transcriptional analysis was performed. Tomato genes differentially expressed upon inoculation with Fol and ToMV were identified at 2 days post-inoculation, using an un-inoculated sample as reference.
2015-11-12 | E-GEOD-52336 | biostudies-arrayexpress
Project description:TMV-resistant (N), -susceptible (n), and enhanced susceptible mutant sun1-1 (N) tomato were grown in asceptic conditions in growth chambers (25º, 16hr/8hr light dark). 4-5 week old tomato were treated with TMV leaf sap or mock leaf sap, and leaf tissue was collected after 3, 9, and 27 hours. RNA was isolated from each sample (leaf tissue from one plant/one treatment/one timepoint), using standard TIGR protocols, and 25ug of total RNA was labeled using TIGR indirect labeling protocols. The experiment was repeated three times. Keywords: Direct comparison
2007-09-01 | GSE8233 | GEO
Project description:Bovine tropical theileriosis is a major haemoprotozoan disease associated with high rates of morbidity and mortality particularly in exotic and crossbred cattle. It is one of the major constraints for of the livestock development programmes in India and southern Asia. Indigenous cattle (Bos indicus) are less affected by this disease than exotic and crossbred cattle. Genetic basis of resistance to tropical theileriosis in indigenous cattle is not well studied. Recent studies gives an idea that differentially genes expressed in exotic and indigenous breeds play an important role in breed specific resistance to tropical theileriosis. The present study was designed to visualize the global gene expression profiling in PBMCs derived from indigenous (Tharparkar) and crossbred cattle with in vitro infection of T. annulata. T. annulata Parbhani strain, originally isolated from Maharashtra (India) and maintained as cryopreserved stabilates of ground-up tick tissue sporozoite (GUTS) of infected H. anatolicum anatolicum was used as infective material. Two separate microarray experiments were carried out using separately each for crossbred and Tharparkar cattle. The crossbred cattle showed 1082 differentially expressed genes (DEGs). Out of total DEGs, 597 genes were downregulated and 485 were upregulated. Their fold change varies from 2283.93 to -4816.02. Tharparkar cattle showed 875 differentially expressed genes. Out of total DEGs in Tharparkar cattle, 451 genes were downregulated and 424 genes were upregulated. Their fold change varies from 94.93 to -19.20. A subset of genes was validated by quantitative RT-PCR and results correlated well with data obtained from the microarrays indicating that the microarray results gave an accurate report of transcript level. Functional annotation study of differentially expressed genes has confirmed their involvement in various pathways including response to oxidative stress, immune system regulation, cell proliferation, cytoskeletal changes, kinases activity and apoptosis. Gene network analysis of these differentially expressed genes provided an effective way to understand the interaction among them. It is therefore, hypothesised that the dissimilar susceptibility to tropical theileriosis exhibited by indigenous and crossbred cattle is due to breed-specific differences in the interaction of infected cells with other immune cells, which ultimately influences the immune response generated against T. annulata infection. Global gene expression profiling in PBMCs derived from indigenous (Tharparkar) and crossbred cattle were studied after in vitro infection of T. annulata Parbhani strain at 2h time period. Two separate microarray experiments were carried out using Bovine (V2) Gene Expression Microarray, 4x44K (Agilent). Two biological replicate samples were profiled per condition (i.e. replicates samples each in crossbred and Tharparkar cattle).
2016-07-01 | E-GEOD-81419 | biostudies-arrayexpress
Project description:We constructed two independent small RNA libraries from leaves of mock and Cucumber mosaic virus (CMV) infected tomatoes, respectively, and sequenced with a high-throughput Illumina Solexa system. Based on sequence analysis and hairpin structure prediction, a total of 50 known miRNAs (32 families) and 568 potentially candidate miRNAs (PC-miRNAs) were firstly identified in tomato, with 12 known miRNAs and 154 PC-miRNAs supported by both the 3p and 5p strands. Comparative analysis revealed 79 miRNAs (including 15 novel tomato miRNAs) and 40 PC-miRNAs were differentially expressed between the two libraries. Among these virus responsive miRNAs, expression patters of some novel tomato miRNAs and PC-miRNAs in mock and in CMV-Fny infected tomatoes were further validated by qRT-PCR. Moreover, we revealed 563 potential targets for 66 tomato miRNAs by the recently developed degradome sequencing approach, including 124 targets for 7 new tomato miRNAs and 97 targets for 24 PC-miRNAs. Target annotation for the newly identified miRNA and PC-miRNAs indicated that they were involved in multiple biological processes, including transcriptional regulation and virus resistance. Gene ontology analysis of these target transcripts demonstrated that stress response- and photosynthesis-related genes were most affected in CMV-Fny infected tomatoes.
2014-10-20 | GSE56974 | GEO
Project description:Tomato mottle mosaic virus cultivar:tomato Raw sequence reads
| PRJNA689058 | ENA
Project description:We constructed two independent small RNA libraries from leaves of mock and Cucumber mosaic virus (CMV) infected tomatoes, respectively, and sequenced with a high-throughput Illumina Solexa system. Based on sequence analysis and hairpin structure prediction, a total of 50 known miRNAs (32 families) and 568 potentially candidate miRNAs (PC-miRNAs) were firstly identified in tomato, with 12 known miRNAs and 154 PC-miRNAs supported by both the 3p and 5p strands. Comparative analysis revealed 79 miRNAs (including 15 novel tomato miRNAs) and 40 PC-miRNAs were differentially expressed between the two libraries. Among these virus responsive miRNAs, expression patters of some novel tomato miRNAs and PC-miRNAs in mock and in CMV-Fny infected tomatoes were further validated by qRT-PCR. Moreover, we revealed 563 potential targets for 66 tomato miRNAs by the recently developed degradome sequencing approach, including 124 targets for 7 new tomato miRNAs and 97 targets for 24 PC-miRNAs. Target annotation for the newly identified miRNA and PC-miRNAs indicated that they were involved in multiple biological processes, including transcriptional regulation and virus resistance. Gene ontology analysis of these target transcripts demonstrated that stress response- and photosynthesis-related genes were most affected in CMV-Fny infected tomatoes. Examination of small RNAs and their targets in mock and CMV-Fny infected tomatoes.
2014-10-20 | E-GEOD-56974 | biostudies-arrayexpress