Transcriptomics

Dataset Information

0

Transcriptome analysis of tumors from genetically engineered mouse models carrying Cbfb and/or Pik3ca mutations


ABSTRACT: Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.

ORGANISM(S): Mus musculus

PROVIDER: GSE206598 | GEO | 2024/10/22

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2022-02-21 | MODEL2202170011 | BioModels
2018-02-14 | GSE103367 | GEO
2013-03-04 | E-GEOD-41723 | biostudies-arrayexpress
2013-03-04 | E-GEOD-41601 | biostudies-arrayexpress
2013-03-04 | E-GEOD-41632 | biostudies-arrayexpress
2023-05-17 | GSE232167 | GEO
2013-03-04 | GSE41601 | GEO
2013-03-04 | GSE41723 | GEO
2013-03-04 | GSE41632 | GEO
| PRJNA456849 | ENA