Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome analysis of tumors from genetically engineered mouse models carrying Cbfb and/or Pik3ca mutations

ABSTRACT: Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.

ORGANISM(S): Mus musculus

PROVIDER: GSE206598 | GEO | 2024/10/22

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Nassar2022 - Microbiome PCR primer NER model

Project description:Microbiome PCR primer model is a Named Entity Recognition (NER) model that identifies and annotates microbiome target gene primers in texts. This is the final model version used to annotate metagenomics publications in Europe PMC and enrich metagenomics studies in MGnify with primer metadata from literature. For more information, please refer to the following blogs: http://blog.europepmc.org/2020/11/europe-pmc-publications-metagenomics-annotations.html https://www.ebi.ac.uk/about/news/service-news/enriched-metadata-fields-mgnify-based-text-mining-associated-publications

2022-02-21 | MODEL2202170011 | BioModels

Gene expression differences between leukemic cells from Mx1-Cre, Cbfb+/56M and Chd7f/f, Mx1-Cre, Cbfb+/56M mice by microarray

Project description:Results showed that Chd7 deficiency delay Cbfb-MYH11 induced leukemia, to explore the mechanism, We also performed microarray analysis on c-Kit+ leukemic cells to determine gene expression differences between Mx1-Cre, Cbfb+/56M and Chd7f/f, Mx1-Cre, Cbfb+/56M leukemic cells.

2018-02-14 | GSE103367 | GEO

Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer (miRNA expression data).

Project description:miRNA profiling of normal and tumorigenic mouse mammary tissue. Mouse genotypes consist of wildtype, MMTV-Met, MMTV-Met;Trp53fl/+;Cre, and Trp53fl/+;Cre. One-color design. Samples consist of 2 normal tissues, 7 MMTV-Met tumors, 8 MMTV-Met;Trp53fl/+;Cre tumors, and 8 Trp53;Cre tumors.

2013-03-04 | E-GEOD-41723 | biostudies-arrayexpress

Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer (mRNA expression data).

Project description:Transcriptional profiling of normal and tumorigenic mouse mammary tissue. Mouse genotypes consist of wildtype, MMTV-Met, MMTV-Met;Trp53fl/+;Cre, and Trp53fl/+;Cre. Two-color common reference design. Samples consist of 11 normal tissues, 8 MMTV-Met tumors, 14 MMTV-Met;Trp53fl/+;Cre tumors, and 8 Trp53;Cre tumors.

2013-03-04 | E-GEOD-41601 | biostudies-arrayexpress

Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer (aCGH data).

Project description:Transcriptional profiling of normal and tumorigenic mouse mammary tissue. Mouse genotypes consist of wildtype, MMTV-Met, MMTV-Met;Trp53fl/+;Cre, and Trp53fl/+;Cre. Two-color common reference design. Samples consist of 4 normal tissues, 8 MMTV-Met tumors, 10 MMTV-Met;Trp53fl/+;Cre tumors, and 8 Trp53;Cre tumors.

2013-03-04 | E-GEOD-41632 | biostudies-arrayexpress

DNA sequences at integration sites in primary mammary tumors and lung metastases from a sleeping-beauty transposon-mediated mutagenesis screen on Rb-deficient background

Project description:This deposition describes DNA sequences at integration sites in primary tumors and lung metastases from a sleeping-beauty transposon-mediated mutagenesis screen on Rb-deficient background in the mammary gland in MMTV-Cre:Rbf/f:T2/Onc3a:R26lsl_SB11 and MMTV-Cre:Rbf/f:T2/Onc3b:R26lsl_SB11 female mice. In these mice, Rb floxed (Rbf/f) alleles and a SB11 transposase, knocked into the ROSA26 locus (R26lsl_SB11), are mobilized via MMTV-Cre. Two different transgenic transposon concatemers, T2/Onc3a and T2/Onc3b, containing 11 and 28 copies on chromosomes 9 and 12 were used so that local hoping in the respective chromosomes can be discarded. These mice developed large primary tumors and macroscopic lung metastases; biopsies from the primary tumors and entire lung metastases were used to extract DNA. The DNA was subjected to sonication, ligation-mediated PCR with 79 bar coded primers, followed by next-generation DNA sequencing. We identified Primary-specific and lung Metastasis-specific gene-centric Common Integration Sites (gCIS) as well as shared gCIS, observed in both primary mammary tumors and lung metastases. Using sequence analysis of integration sites, we were able to demonstrate in multiple cases clonal relationship between primary lesions and metastases. The metastatic gCIS form specific hubs that may be prioritized for targeted therapy. For details, see reference below.

2023-05-17 | GSE232167 | GEO

Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer (miRNA expression data).

Project description:miRNA profiling of normal and tumorigenic mouse mammary tissue. Mouse genotypes consist of wildtype, MMTV-Met, MMTV-Met;Trp53fl/+;Cre, and Trp53fl/+;Cre.

2013-03-04 | GSE41723 | GEO

Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer (aCGH data).

Project description:Transcriptional profiling of normal and tumorigenic mouse mammary tissue. Mouse genotypes consist of wildtype, MMTV-Met, MMTV-Met;Trp53fl/+;Cre, and Trp53fl/+;Cre.

2013-03-04 | GSE41632 | GEO

Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer (mRNA expression data).

Project description:Transcriptional profiling of normal and tumorigenic mouse mammary tissue. Mouse genotypes consist of wildtype, MMTV-Met, MMTV-Met;Trp53fl/+;Cre, and Trp53fl/+;Cre.

2013-03-04 | GSE41601 | GEO

Gelatoporia subvermispora strain:FP-105752-RP-A

Project description:Ceriporiopsis subvermispora FP-105752-RP-A Resequencing

| PRJNA456849 | ENA